ID: 1040959778

View in Genome Browser
Species Human (GRCh38)
Location 8:53019326-53019348
Sequence CCAGTGAGGAAGGGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040959778_1040959791 25 Left 1040959778 8:53019326-53019348 CCTGACACACCCTTCCTCACTGG No data
Right 1040959791 8:53019374-53019396 ACAACTCCAGCCAGAAGCTCAGG No data
1040959778_1040959787 -5 Left 1040959778 8:53019326-53019348 CCTGACACACCCTTCCTCACTGG No data
Right 1040959787 8:53019344-53019366 ACTGGGTGGGGCTTCCCTGCAGG No data
1040959778_1040959792 26 Left 1040959778 8:53019326-53019348 CCTGACACACCCTTCCTCACTGG No data
Right 1040959792 8:53019375-53019397 CAACTCCAGCCAGAAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040959778 Original CRISPR CCAGTGAGGAAGGGTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr