ID: 1040960542

View in Genome Browser
Species Human (GRCh38)
Location 8:53027439-53027461
Sequence GCTTCAATGACCCCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040960540_1040960542 -3 Left 1040960540 8:53027419-53027441 CCAAGACAAAGGGAGCCTCTGCT No data
Right 1040960542 8:53027439-53027461 GCTTCAATGACCCCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040960542 Original CRISPR GCTTCAATGACCCCACCAGC TGG Intergenic
No off target data available for this crispr