ID: 1040960995

View in Genome Browser
Species Human (GRCh38)
Location 8:53032646-53032668
Sequence TTGAAGATACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040960995_1040960997 14 Left 1040960995 8:53032646-53032668 CCATTGTCCATTTGTATCTTCAA No data
Right 1040960997 8:53032683-53032705 TAGAAACAGCAATTTCCCCAAGG No data
1040960995_1040960998 15 Left 1040960995 8:53032646-53032668 CCATTGTCCATTTGTATCTTCAA No data
Right 1040960998 8:53032684-53032706 AGAAACAGCAATTTCCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040960995 Original CRISPR TTGAAGATACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr