ID: 1040968240

View in Genome Browser
Species Human (GRCh38)
Location 8:53106163-53106185
Sequence ACATACAGAATATACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040968240_1040968243 8 Left 1040968240 8:53106163-53106185 CCTTCCCTGTATATTCTGTATGT No data
Right 1040968243 8:53106194-53106216 ATACAAAGCATTTGACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040968240 Original CRISPR ACATACAGAATATACAGGGA AGG (reversed) Intergenic
No off target data available for this crispr