ID: 1040972533

View in Genome Browser
Species Human (GRCh38)
Location 8:53152355-53152377
Sequence AGTAGGAATGTGCCTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040972528_1040972533 11 Left 1040972528 8:53152321-53152343 CCAACACTTGGAGCAGGATTGCT No data
Right 1040972533 8:53152355-53152377 AGTAGGAATGTGCCTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040972533 Original CRISPR AGTAGGAATGTGCCTACAGT GGG Intergenic
No off target data available for this crispr