ID: 1040973444

View in Genome Browser
Species Human (GRCh38)
Location 8:53163444-53163466
Sequence CTGAGGATACAGAGCCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040973444_1040973449 -6 Left 1040973444 8:53163444-53163466 CCGTCCTGGCTCTGTATCCTCAG No data
Right 1040973449 8:53163461-53163483 CCTCAGTGGAGCCTTTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040973444 Original CRISPR CTGAGGATACAGAGCCAGGA CGG (reversed) Intergenic
No off target data available for this crispr