ID: 1040973622

View in Genome Browser
Species Human (GRCh38)
Location 8:53165022-53165044
Sequence CACAGCATGGTGAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040973622_1040973628 10 Left 1040973622 8:53165022-53165044 CCCTTCCCCTTCACCATGCTGTG No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040973622 Original CRISPR CACAGCATGGTGAAGGGGAA GGG (reversed) Intergenic
No off target data available for this crispr