ID: 1040973628

View in Genome Browser
Species Human (GRCh38)
Location 8:53165055-53165077
Sequence GATGTTGACATCATGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040973622_1040973628 10 Left 1040973622 8:53165022-53165044 CCCTTCCCCTTCACCATGCTGTG No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973624_1040973628 5 Left 1040973624 8:53165027-53165049 CCCCTTCACCATGCTGTGACGCT No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973627_1040973628 -3 Left 1040973627 8:53165035-53165057 CCATGCTGTGACGCTGAGCAGAT No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973626_1040973628 3 Left 1040973626 8:53165029-53165051 CCTTCACCATGCTGTGACGCTGA No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973623_1040973628 9 Left 1040973623 8:53165023-53165045 CCTTCCCCTTCACCATGCTGTGA No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973621_1040973628 11 Left 1040973621 8:53165021-53165043 CCCCTTCCCCTTCACCATGCTGT No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data
1040973625_1040973628 4 Left 1040973625 8:53165028-53165050 CCCTTCACCATGCTGTGACGCTG No data
Right 1040973628 8:53165055-53165077 GATGTTGACATCATGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040973628 Original CRISPR GATGTTGACATCATGCTTCC TGG Intergenic
No off target data available for this crispr