ID: 1040974052

View in Genome Browser
Species Human (GRCh38)
Location 8:53170332-53170354
Sequence ATTTTTAAGGGGGTCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040974052_1040974062 5 Left 1040974052 8:53170332-53170354 CCATCCATGACCCCCTTAAAAAT No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974052_1040974058 -3 Left 1040974052 8:53170332-53170354 CCATCCATGACCCCCTTAAAAAT No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040974052 Original CRISPR ATTTTTAAGGGGGTCATGGA TGG (reversed) Intergenic
No off target data available for this crispr