ID: 1040974058

View in Genome Browser
Species Human (GRCh38)
Location 8:53170352-53170374
Sequence AATCCCATCCCAGAACTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040974051_1040974058 2 Left 1040974051 8:53170327-53170349 CCTCTCCATCCATGACCCCCTTA No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974047_1040974058 18 Left 1040974047 8:53170311-53170333 CCCCAATTTTCCAGTACCTCTCC No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974052_1040974058 -3 Left 1040974052 8:53170332-53170354 CCATCCATGACCCCCTTAAAAAT No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974048_1040974058 17 Left 1040974048 8:53170312-53170334 CCCAATTTTCCAGTACCTCTCCA No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974046_1040974058 29 Left 1040974046 8:53170300-53170322 CCAATCAAAGACCCCAATTTTCC No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974050_1040974058 8 Left 1040974050 8:53170321-53170343 CCAGTACCTCTCCATCCATGACC No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974053_1040974058 -7 Left 1040974053 8:53170336-53170358 CCATGACCCCCTTAAAAATCCCA No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data
1040974049_1040974058 16 Left 1040974049 8:53170313-53170335 CCAATTTTCCAGTACCTCTCCAT No data
Right 1040974058 8:53170352-53170374 AATCCCATCCCAGAACTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040974058 Original CRISPR AATCCCATCCCAGAACTCCT TGG Intergenic
No off target data available for this crispr