ID: 1040974062

View in Genome Browser
Species Human (GRCh38)
Location 8:53170360-53170382
Sequence CCCAGAACTCCTTGGTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040974048_1040974062 25 Left 1040974048 8:53170312-53170334 CCCAATTTTCCAGTACCTCTCCA No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974053_1040974062 1 Left 1040974053 8:53170336-53170358 CCATGACCCCCTTAAAAATCCCA No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974051_1040974062 10 Left 1040974051 8:53170327-53170349 CCTCTCCATCCATGACCCCCTTA No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974047_1040974062 26 Left 1040974047 8:53170311-53170333 CCCCAATTTTCCAGTACCTCTCC No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974055_1040974062 -6 Left 1040974055 8:53170343-53170365 CCCCTTAAAAATCCCATCCCAGA No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974057_1040974062 -8 Left 1040974057 8:53170345-53170367 CCTTAAAAATCCCATCCCAGAAC No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974054_1040974062 -5 Left 1040974054 8:53170342-53170364 CCCCCTTAAAAATCCCATCCCAG No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974052_1040974062 5 Left 1040974052 8:53170332-53170354 CCATCCATGACCCCCTTAAAAAT No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974050_1040974062 16 Left 1040974050 8:53170321-53170343 CCAGTACCTCTCCATCCATGACC No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974049_1040974062 24 Left 1040974049 8:53170313-53170335 CCAATTTTCCAGTACCTCTCCAT No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data
1040974056_1040974062 -7 Left 1040974056 8:53170344-53170366 CCCTTAAAAATCCCATCCCAGAA No data
Right 1040974062 8:53170360-53170382 CCCAGAACTCCTTGGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040974062 Original CRISPR CCCAGAACTCCTTGGTTAGA TGG Intergenic
No off target data available for this crispr