ID: 1040974876

View in Genome Browser
Species Human (GRCh38)
Location 8:53178825-53178847
Sequence GTGCAGAGGCAGATAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040974869_1040974876 10 Left 1040974869 8:53178792-53178814 CCACTGAAACAGAAGAGAAAGTG No data
Right 1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG No data
1040974868_1040974876 27 Left 1040974868 8:53178775-53178797 CCTGCAGTATTGTATGTCCACTG No data
Right 1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040974876 Original CRISPR GTGCAGAGGCAGATAGAGCA GGG Intergenic
No off target data available for this crispr