ID: 1040977826

View in Genome Browser
Species Human (GRCh38)
Location 8:53214182-53214204
Sequence CTGCTGTGCTAGAGGCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040977823_1040977826 -6 Left 1040977823 8:53214165-53214187 CCTTGGAGGTTAGGAACCTGCTG 0: 3
1: 11
2: 35
3: 92
4: 236
Right 1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG No data
1040977818_1040977826 13 Left 1040977818 8:53214146-53214168 CCTGGCTTTGTTCTATGGCCCTT No data
Right 1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG No data
1040977822_1040977826 -5 Left 1040977822 8:53214164-53214186 CCCTTGGAGGTTAGGAACCTGCT No data
Right 1040977826 8:53214182-53214204 CTGCTGTGCTAGAGGCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040977826 Original CRISPR CTGCTGTGCTAGAGGCTCCA CGG Intergenic
No off target data available for this crispr