ID: 1040979447

View in Genome Browser
Species Human (GRCh38)
Location 8:53230758-53230780
Sequence GTGTGCTCGCTGACTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040979447_1040979449 -1 Left 1040979447 8:53230758-53230780 CCCTGAGAAGTCAGCGAGCACAC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1040979449 8:53230780-53230802 CAGCAGAGCTCTCTTTGCCCTGG No data
1040979447_1040979452 18 Left 1040979447 8:53230758-53230780 CCCTGAGAAGTCAGCGAGCACAC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1040979452 8:53230799-53230821 CTGGTCCTTCCTCACAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040979447 Original CRISPR GTGTGCTCGCTGACTTCTCA GGG (reversed) Intronic
900373408 1:2342545-2342567 GTGTTCCCGCTGACTTCTCCAGG - Intronic
904364606 1:30002321-30002343 GTGTGCTCCCTGAACTCCCAGGG - Intergenic
911775129 1:101799925-101799947 GTTTACTAGCAGACTTCTCAGGG + Intergenic
914333931 1:146698171-146698193 GTGTGCTTGCTGGCCTCACAGGG - Intergenic
918574804 1:186044820-186044842 GTGGGCTCCATAACTTCTCAAGG - Intronic
918794415 1:188874310-188874332 GTGTGCTCCCTCTCCTCTCAGGG - Intergenic
920732121 1:208497099-208497121 GGGTGCTCGGTGACTGCTGAAGG + Intergenic
923237527 1:232048577-232048599 GGTTGCTCACTTACTTCTCAAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064864824 10:19867558-19867580 GGTTGCTCCCTGACTCCTCAAGG + Intronic
1067068800 10:43118156-43118178 GTGTGGTTGCTGGCTCCTCAGGG + Intronic
1075253371 10:120903121-120903143 TTGTGCTGGCTGACTTTTCCTGG - Exonic
1085314743 11:75537812-75537834 GTGTCCTCGCTGACACCTCCTGG - Intergenic
1087081222 11:94172877-94172899 CTTTGCTCGCTGTCTTCTCCAGG + Intronic
1092689529 12:11092301-11092323 GTGGTCTCGCTGACTTCAAAAGG + Exonic
1107533724 13:41308560-41308582 GTGTGCTTGCTCAGTTCTCCGGG + Intergenic
1108650896 13:52478549-52478571 ATGTCCTCCTTGACTTCTCAGGG + Intergenic
1115853528 14:37605998-37606020 GAGTGGTAGCTGACTTCCCAGGG + Intronic
1116919691 14:50560207-50560229 CTGCGCTCGCTGCCTTCTCCGGG - Exonic
1119249121 14:73136826-73136848 GTTTGCTCGAAGACGTCTCAGGG + Intronic
1130770785 15:86921519-86921541 GGTTGCTCACTTACTTCTCAAGG + Intronic
1136902980 16:34061480-34061502 GTCTGCTCGCTGCGTTCCCATGG + Intergenic
1139999687 16:71013078-71013100 GTGTGCTTGCTGGCCTCACAGGG + Intronic
1143957038 17:10678913-10678935 GTTTTCTCTCTGGCTTCTCATGG + Exonic
1144031070 17:11324017-11324039 GTGTGCACGCTGAGATGTCAAGG - Intronic
1144207470 17:12989212-12989234 CTGTGCTTGCTGACTCCTCCAGG - Intronic
1145009135 17:19357493-19357515 CTGTGCCTGCTGACTTCCCATGG - Intronic
1151213326 17:72560853-72560875 GAGTGCACGGTGACTTCTCAGGG + Intergenic
1151297895 17:73199028-73199050 GGGTACTGGCTGACTTGTCATGG + Intronic
1154485565 18:14868907-14868929 GTGTTGTCTCTGGCTTCTCACGG + Intergenic
1157128740 18:44983008-44983030 GGGTTTTCGGTGACTTCTCAGGG - Intronic
1160804301 19:985084-985106 GTGTGCCCGCTGAGATCTCTTGG + Intronic
925579566 2:5396957-5396979 GTGTGCTCGTTGACTTCTATTGG - Intergenic
926724608 2:15987522-15987544 GTGTCCTTGTTGACTTCTCCAGG - Intergenic
936502012 2:113074091-113074113 CTGTGCTTCCTGCCTTCTCATGG - Intronic
936576834 2:113664308-113664330 ATGTGCTCACTGTTTTCTCATGG - Intergenic
937002659 2:118482350-118482372 ATGTGCCTGCTGACTACTCAAGG - Intergenic
937116571 2:119409176-119409198 GTGGGCTCCCTGCCTTCTTAAGG + Intergenic
937252322 2:120532848-120532870 GGGAGCGCGGTGACTTCTCAGGG - Intergenic
939608882 2:144286066-144286088 GTGTGTTGGCTGTCTTCTAAGGG - Intronic
940132638 2:150401025-150401047 GTGTGTTTGCAGACATCTCATGG - Intergenic
940984923 2:160043357-160043379 GCCTGCTGGCTGCCTTCTCAGGG + Intronic
945461758 2:210117537-210117559 GTCTGGTAGCAGACTTCTCAGGG + Intronic
945977908 2:216284911-216284933 GAGTGGTCCCTGACTTCTCCAGG + Intronic
1170734255 20:19000260-19000282 CTGTGCTTGCAGGCTTCTCAAGG + Intergenic
1173491021 20:43481752-43481774 CTGTGCTCCATGACTCCTCATGG - Intergenic
1176795770 21:13370569-13370591 GTGTTGTCTCTGGCTTCTCACGG - Intergenic
1179267609 21:39818506-39818528 GTCTGCTGCCTGACTTCTCTTGG - Intergenic
1185423578 22:50749021-50749043 ATGTGCTCACTGTTTTCTCATGG + Intergenic
954597011 3:51834314-51834336 GTGTGCTCGGGGACTTCAGATGG - Intergenic
959155969 3:102666459-102666481 GTTTGCTCACTTACTTTTCAAGG - Intergenic
960172815 3:114482262-114482284 GTGGGCTCTCAGACATCTCAGGG + Intronic
966918533 3:184597816-184597838 CTGGGCTCGGGGACTTCTCAGGG + Intronic
966959816 3:184924194-184924216 GTGTGATAGCTGACTTCTCTGGG + Intronic
970617311 4:17780563-17780585 GTGGGCTGGCTGACTTCCCTAGG + Intronic
970786092 4:19798002-19798024 GAGTGCTCACTCAGTTCTCATGG - Intergenic
971213609 4:24643270-24643292 GAATACTCTCTGACTTCTCAGGG - Intergenic
973134469 4:46689328-46689350 GTGTGCTCGCTAGGGTCTCAGGG - Intergenic
976396666 4:84563169-84563191 GGGTTCTCACTGACTACTCAAGG + Intergenic
977251174 4:94691452-94691474 GAGTCCTCCCTGACTTCTCTAGG + Intergenic
979158482 4:117429022-117429044 CTTTGCTCTCTGGCTTCTCAAGG + Intergenic
984360290 4:178721255-178721277 GTATCCTCCATGACTTCTCATGG + Intergenic
984856949 4:184203680-184203702 GTGTTCTCTCTGAAGTCTCAAGG - Intronic
985005261 4:185528640-185528662 CTGTCCTAGCTGACTTCTGAAGG - Intronic
990469656 5:56103328-56103350 CTGTGCTTGCTGATTTTTCACGG - Intronic
993040015 5:82803785-82803807 GTGTGCTCCCAAACTTTTCATGG - Intergenic
994648427 5:102498338-102498360 GGCTGCTTTCTGACTTCTCAAGG - Intronic
995057665 5:107778241-107778263 GATTGCTCCCTGCCTTCTCAGGG + Intergenic
995909830 5:117173126-117173148 GTTTGCTCAGTGACTTTTCATGG + Intergenic
997014032 5:129909388-129909410 GTGTGTTTGGTGACTTCACAGGG - Intronic
998404472 5:141866351-141866373 GTGTGCCCGCTGACTGCAGAGGG - Intronic
999062718 5:148653772-148653794 GTGTGCTCACTGACTATACAAGG - Intronic
1002193693 5:177491390-177491412 GGGGGCTCACTGACTTGTCAGGG + Intronic
1004379493 6:15120175-15120197 TTCTGCTGGCTGACGTCTCAGGG - Intergenic
1004466889 6:15894247-15894269 ATGTGCTCCCTGATTTGTCATGG - Intergenic
1004802501 6:19165640-19165662 GTTTCCTCCCTGTCTTCTCATGG - Intergenic
1005117405 6:22354035-22354057 GTGTGGACACTGACTTGTCAAGG - Intergenic
1007545650 6:42691750-42691772 GTGTGCTGGCTGGTTTTTCAGGG + Exonic
1007545841 6:42693860-42693882 GTGTGCTGGCTGGTTTTTCAGGG + Intergenic
1010841820 6:80655280-80655302 GTGTGCTCTTTGACTTATGAGGG + Intergenic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1024261115 7:47574414-47574436 GGGTGCTGGCTGGATTCTCACGG - Intronic
1025101166 7:56136386-56136408 GGTTGCTCACTTACTTCTCAGGG + Intergenic
1027343958 7:77238239-77238261 GTGTGTTCTCAGAGTTCTCAAGG + Intronic
1029181648 7:98706158-98706180 GTCCGCTCACTGACCTCTCAGGG - Intergenic
1033570633 7:142625104-142625126 GTGTGCTCCTTGACTTATGATGG - Intergenic
1034114368 7:148570673-148570695 CTCTGCTCCCTGAATTCTCAGGG - Intergenic
1039429980 8:37518659-37518681 GTGTGCGCGCTTCGTTCTCAGGG + Intergenic
1039566542 8:38556014-38556036 GTGTGCTCGTTCTCTGCTCAGGG + Intergenic
1040979447 8:53230758-53230780 GTGTGCTCGCTGACTTCTCAGGG - Intronic
1042505711 8:69557576-69557598 GTTTTCTCTCTGTCTTCTCAGGG - Intronic
1043945220 8:86243542-86243564 GTGAGATCCCTGCCTTCTCAGGG + Intronic
1049962558 9:750625-750647 GTGAGCTCTCTGAACTCTCAGGG - Intergenic
1052882944 9:33616222-33616244 GTGTGCTCCTTGACTTATGATGG - Intergenic
1053477605 9:38393395-38393417 GTTTGCAGGCTGTCTTCTCACGG - Intronic
1055934243 9:81590165-81590187 GTGTGAGCACTGACTTCTGAAGG + Intronic
1056377419 9:86028246-86028268 GTGTGCCCGCTGGGGTCTCAGGG - Intronic
1057890416 9:98865652-98865674 GTCTGCTCTCTGTCTTCTGAGGG + Intergenic
1058596705 9:106622813-106622835 GTGGGCTTACTGGCTTCTCAAGG + Intergenic
1061245642 9:129400181-129400203 GTGTGCTCCCTCGCGTCTCACGG - Intergenic
1187004954 X:15223674-15223696 CTGTGTTATCTGACTTCTCATGG - Intergenic
1195070124 X:101270916-101270938 GTGTGCATGCTGCTTTCTCATGG + Intronic
1198825289 X:140692388-140692410 GGTTGCTCACTTACTTCTCAAGG + Intergenic
1200210305 X:154344192-154344214 GTGTGCTCTCTGGCTCTTCATGG + Intergenic
1200220547 X:154387900-154387922 GTGTGCTCTCTGGCTCTTCATGG - Intergenic