ID: 1040984404

View in Genome Browser
Species Human (GRCh38)
Location 8:53278276-53278298
Sequence CAGCAGGCCTGCAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040984400_1040984404 25 Left 1040984400 8:53278228-53278250 CCAGTTCTCAACAATGTAGGGAT No data
Right 1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040984404 Original CRISPR CAGCAGGCCTGCAGAGAAGT GGG Intergenic
No off target data available for this crispr