ID: 1040985572

View in Genome Browser
Species Human (GRCh38)
Location 8:53290630-53290652
Sequence GTTTTTAAGGAGATCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040985568_1040985572 -4 Left 1040985568 8:53290611-53290633 CCCAGGAGTTCTGGGTTGGGTTT No data
Right 1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG No data
1040985569_1040985572 -5 Left 1040985569 8:53290612-53290634 CCAGGAGTTCTGGGTTGGGTTTT No data
Right 1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG No data
1040985565_1040985572 3 Left 1040985565 8:53290604-53290626 CCATCTTCCCAGGAGTTCTGGGT No data
Right 1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG No data
1040985562_1040985572 11 Left 1040985562 8:53290596-53290618 CCTTATATCCATCTTCCCAGGAG No data
Right 1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040985572 Original CRISPR GTTTTTAAGGAGATCATGAA GGG Intergenic
No off target data available for this crispr