ID: 1040987557

View in Genome Browser
Species Human (GRCh38)
Location 8:53313119-53313141
Sequence AGAACCGAGATCTCATCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040987557_1040987561 10 Left 1040987557 8:53313119-53313141 CCTGGTGATGAGATCTCGGTTCT No data
Right 1040987561 8:53313152-53313174 GCAAGAGAACAGACAAGGACTGG No data
1040987557_1040987560 5 Left 1040987557 8:53313119-53313141 CCTGGTGATGAGATCTCGGTTCT No data
Right 1040987560 8:53313147-53313169 ATAGGGCAAGAGAACAGACAAGG No data
1040987557_1040987563 28 Left 1040987557 8:53313119-53313141 CCTGGTGATGAGATCTCGGTTCT No data
Right 1040987563 8:53313170-53313192 ACTGGACCCTGAAAGGCATTTGG No data
1040987557_1040987562 21 Left 1040987557 8:53313119-53313141 CCTGGTGATGAGATCTCGGTTCT No data
Right 1040987562 8:53313163-53313185 GACAAGGACTGGACCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040987557 Original CRISPR AGAACCGAGATCTCATCACC AGG (reversed) Intergenic
No off target data available for this crispr