ID: 1040991178

View in Genome Browser
Species Human (GRCh38)
Location 8:53352178-53352200
Sequence AGATTTTTATAGGAGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040991178_1040991186 16 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991186 8:53352217-53352239 CCTCTCAGCAGGAGTTGTGGAGG No data
1040991178_1040991181 5 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991181 8:53352206-53352228 TTTCCCAGAGGCCTCTCAGCAGG No data
1040991178_1040991180 -7 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991180 8:53352194-53352216 AAAATCTTTTTCTTTCCCAGAGG No data
1040991178_1040991188 18 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991188 8:53352219-53352241 TCTCAGCAGGAGTTGTGGAGGGG No data
1040991178_1040991187 17 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991187 8:53352218-53352240 CTCTCAGCAGGAGTTGTGGAGGG No data
1040991178_1040991184 13 Left 1040991178 8:53352178-53352200 CCATGGAGCTCCTATAAAAATCT No data
Right 1040991184 8:53352214-53352236 AGGCCTCTCAGCAGGAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040991178 Original CRISPR AGATTTTTATAGGAGCTCCA TGG (reversed) Intergenic
No off target data available for this crispr