ID: 1040991675

View in Genome Browser
Species Human (GRCh38)
Location 8:53358150-53358172
Sequence ATTTTTGTACAGGTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040991668_1040991675 12 Left 1040991668 8:53358115-53358137 CCCAGAGACGTCCCACAACATGC No data
Right 1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG No data
1040991669_1040991675 11 Left 1040991669 8:53358116-53358138 CCAGAGACGTCCCACAACATGCC No data
Right 1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG No data
1040991670_1040991675 1 Left 1040991670 8:53358126-53358148 CCCACAACATGCCTAAAATCATA No data
Right 1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG No data
1040991672_1040991675 -10 Left 1040991672 8:53358137-53358159 CCTAAAATCATAGATTTTTGTAC No data
Right 1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG No data
1040991671_1040991675 0 Left 1040991671 8:53358127-53358149 CCACAACATGCCTAAAATCATAG No data
Right 1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040991675 Original CRISPR ATTTTTGTACAGGTGGAGCC TGG Intergenic
No off target data available for this crispr