ID: 1040997583

View in Genome Browser
Species Human (GRCh38)
Location 8:53417691-53417713
Sequence CCAAAATGTAACCACCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040997578_1040997583 -9 Left 1040997578 8:53417677-53417699 CCCTCCCTGTAAGACCAAAATGT No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data
1040997576_1040997583 16 Left 1040997576 8:53417652-53417674 CCTATCAAGGAGAACAGTTTTCT No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data
1040997575_1040997583 21 Left 1040997575 8:53417647-53417669 CCAGACCTATCAAGGAGAACAGT No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data
1040997579_1040997583 -10 Left 1040997579 8:53417678-53417700 CCTCCCTGTAAGACCAAAATGTA No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data
1040997577_1040997583 -8 Left 1040997577 8:53417676-53417698 CCCCTCCCTGTAAGACCAAAATG No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data
1040997573_1040997583 29 Left 1040997573 8:53417639-53417661 CCTAAGATCCAGACCTATCAAGG No data
Right 1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040997583 Original CRISPR CCAAAATGTAACCACCTGAA TGG Intergenic
No off target data available for this crispr