ID: 1040999029

View in Genome Browser
Species Human (GRCh38)
Location 8:53431465-53431487
Sequence CTGGAGTGCTTGGGAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040999029_1040999036 21 Left 1040999029 8:53431465-53431487 CCACATTTTCCCAAGCACTCCAG No data
Right 1040999036 8:53431509-53431531 GCTTGAAGATTGAGTGATTGTGG No data
1040999029_1040999033 -4 Left 1040999029 8:53431465-53431487 CCACATTTTCCCAAGCACTCCAG No data
Right 1040999033 8:53431484-53431506 CCAGCTCAGTTAAAAGTCCCTGG No data
1040999029_1040999037 22 Left 1040999029 8:53431465-53431487 CCACATTTTCCCAAGCACTCCAG No data
Right 1040999037 8:53431510-53431532 CTTGAAGATTGAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040999029 Original CRISPR CTGGAGTGCTTGGGAAAATG TGG (reversed) Intergenic
No off target data available for this crispr