ID: 1041008753

View in Genome Browser
Species Human (GRCh38)
Location 8:53521221-53521243
Sequence GCCTCCAGAGTAACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041008752_1041008753 -5 Left 1041008752 8:53521203-53521225 CCGTACATAGACTGGTCAGCCTC No data
Right 1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041008753 Original CRISPR GCCTCCAGAGTAACCAGAGC AGG Intergenic
No off target data available for this crispr