ID: 1041008988

View in Genome Browser
Species Human (GRCh38)
Location 8:53523228-53523250
Sequence AAGGGCCTGTTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041008988_1041008998 19 Left 1041008988 8:53523228-53523250 CCCCCAGAGTTCAACAGGCCCTT No data
Right 1041008998 8:53523270-53523292 ATGCACTTGGAGGGTTAAAAAGG 0: 6
1: 30
2: 20
3: 28
4: 144
1041008988_1041008994 6 Left 1041008988 8:53523228-53523250 CCCCCAGAGTTCAACAGGCCCTT No data
Right 1041008994 8:53523257-53523279 TATATAATGCTCCATGCACTTGG 0: 11
1: 8
2: 11
3: 17
4: 128
1041008988_1041008996 10 Left 1041008988 8:53523228-53523250 CCCCCAGAGTTCAACAGGCCCTT No data
Right 1041008996 8:53523261-53523283 TAATGCTCCATGCACTTGGAGGG 0: 11
1: 17
2: 29
3: 36
4: 107
1041008988_1041008995 9 Left 1041008988 8:53523228-53523250 CCCCCAGAGTTCAACAGGCCCTT No data
Right 1041008995 8:53523260-53523282 ATAATGCTCCATGCACTTGGAGG 0: 11
1: 19
2: 26
3: 38
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041008988 Original CRISPR AAGGGCCTGTTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr