ID: 1041011174

View in Genome Browser
Species Human (GRCh38)
Location 8:53545251-53545273
Sequence CACCTAAGGAACCTGGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041011167_1041011174 11 Left 1041011167 8:53545217-53545239 CCCTGAGATATCTACTTGTTGAG No data
Right 1041011174 8:53545251-53545273 CACCTAAGGAACCTGGTAACAGG No data
1041011166_1041011174 21 Left 1041011166 8:53545207-53545229 CCTGCTTGGACCCTGAGATATCT No data
Right 1041011174 8:53545251-53545273 CACCTAAGGAACCTGGTAACAGG No data
1041011168_1041011174 10 Left 1041011168 8:53545218-53545240 CCTGAGATATCTACTTGTTGAGG No data
Right 1041011174 8:53545251-53545273 CACCTAAGGAACCTGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041011174 Original CRISPR CACCTAAGGAACCTGGTAAC AGG Intergenic
No off target data available for this crispr