ID: 1041023056

View in Genome Browser
Species Human (GRCh38)
Location 8:53657697-53657719
Sequence TGCTGCCGCCTAGGCAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041023056_1041023069 26 Left 1041023056 8:53657697-53657719 CCCCAACTGCCTAGGCGGCAGCA No data
Right 1041023069 8:53657746-53657768 CGGCCTCCCCTCCGCAGAGCTGG No data
1041023056_1041023070 27 Left 1041023056 8:53657697-53657719 CCCCAACTGCCTAGGCGGCAGCA No data
Right 1041023070 8:53657747-53657769 GGCCTCCCCTCCGCAGAGCTGGG No data
1041023056_1041023064 6 Left 1041023056 8:53657697-53657719 CCCCAACTGCCTAGGCGGCAGCA No data
Right 1041023064 8:53657726-53657748 CTGGGGACGCAGCTCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041023056 Original CRISPR TGCTGCCGCCTAGGCAGTTG GGG (reversed) Intergenic
No off target data available for this crispr