ID: 1041024026

View in Genome Browser
Species Human (GRCh38)
Location 8:53665963-53665985
Sequence CCTTGTCTGGAGACAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041024022_1041024026 1 Left 1041024022 8:53665939-53665961 CCACTGAGCACAGCTTTGGACCT No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data
1041024018_1041024026 23 Left 1041024018 8:53665917-53665939 CCCCAAGAAGATCAAAGTTTAAC No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data
1041024019_1041024026 22 Left 1041024019 8:53665918-53665940 CCCAAGAAGATCAAAGTTTAACC No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data
1041024016_1041024026 30 Left 1041024016 8:53665910-53665932 CCCACTTCCCCAAGAAGATCAAA No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data
1041024017_1041024026 29 Left 1041024017 8:53665911-53665933 CCACTTCCCCAAGAAGATCAAAG No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data
1041024020_1041024026 21 Left 1041024020 8:53665919-53665941 CCAAGAAGATCAAAGTTTAACCA No data
Right 1041024026 8:53665963-53665985 CCTTGTCTGGAGACAATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041024026 Original CRISPR CCTTGTCTGGAGACAATGTC TGG Intergenic
No off target data available for this crispr