ID: 1041025949

View in Genome Browser
Species Human (GRCh38)
Location 8:53687125-53687147
Sequence GTGTTATCCTTGGGGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041025944_1041025949 10 Left 1041025944 8:53687092-53687114 CCTGGTTTTAATATTGTACTAGA No data
Right 1041025949 8:53687125-53687147 GTGTTATCCTTGGGGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041025949 Original CRISPR GTGTTATCCTTGGGGAAAAC TGG Intergenic
No off target data available for this crispr