ID: 1041028985

View in Genome Browser
Species Human (GRCh38)
Location 8:53717065-53717087
Sequence AGGCGATAGGCAAGAGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041028985_1041028989 15 Left 1041028985 8:53717065-53717087 CCATCGTCTCTTGCCTATCGCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1041028989 8:53717103-53717125 ATCGCCAAGAAACCACCTTTGGG No data
1041028985_1041028991 17 Left 1041028985 8:53717065-53717087 CCATCGTCTCTTGCCTATCGCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data
1041028985_1041028990 16 Left 1041028985 8:53717065-53717087 CCATCGTCTCTTGCCTATCGCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1041028990 8:53717104-53717126 TCGCCAAGAAACCACCTTTGGGG No data
1041028985_1041028988 14 Left 1041028985 8:53717065-53717087 CCATCGTCTCTTGCCTATCGCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1041028988 8:53717102-53717124 CATCGCCAAGAAACCACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041028985 Original CRISPR AGGCGATAGGCAAGAGACGA TGG (reversed) Intronic
902054204 1:13586590-13586612 AGGCGATGGGAATGAGAGGATGG - Intronic
904842289 1:33380332-33380354 AGGGGATAGGCAGGGGACAAGGG - Intronic
907467734 1:54650605-54650627 AGGCAAGAGGGAAGAGAAGAAGG - Intronic
908204352 1:61830114-61830136 AGGCTTTGGGCAAGAGACTATGG - Intronic
910647442 1:89528837-89528859 AGGGGAAAGGCAAGAGCCCATGG + Intronic
911884839 1:103284987-103285009 AGGTTATAGGCAAGAGAATATGG - Intergenic
915910003 1:159909006-159909028 AGGGGACAGGGAAGAGAGGAGGG - Intergenic
919513887 1:198497591-198497613 AGGCTATCGGCAAGAGATGATGG - Intergenic
919773287 1:201176727-201176749 AGGCCAGAGGCCAGAGACAAAGG - Intergenic
920940970 1:210481990-210482012 AGGAGAGTGGCAGGAGACGAGGG + Intronic
921178713 1:212615074-212615096 AGGGGACAGGCAGGGGACGATGG - Exonic
1067855550 10:49789593-49789615 AGGTCATAGGTAAGAGACAAAGG - Intergenic
1082201129 11:49369007-49369029 AGGCGATAGTGAAGAGGGGAGGG - Intergenic
1086654549 11:89337208-89337230 AGGCGATAGTGAAGAGGGGAGGG + Intronic
1096565436 12:52473781-52473803 AGGCGAGAGGCAGGAGAAGCAGG + Exonic
1099417846 12:82415622-82415644 AGTCCAAAGGCAAGAGAAGACGG + Intronic
1103409371 12:120699964-120699986 AGGCTAGAGGCAGGAGAAGAAGG - Exonic
1103690240 12:122766750-122766772 AGGCCACAGGCAGGAGAGGAGGG - Intronic
1108502739 13:51083459-51083481 AGGCAATTGACAAGAGAAGAAGG - Intergenic
1113571813 13:111363289-111363311 GGGGGAAAGGCATGAGACGAAGG - Intergenic
1114412659 14:22515496-22515518 AGACAATAGGCAAGAGAGAAGGG - Intergenic
1116791139 14:49341647-49341669 ATGCTATAGGCAAGAGATGATGG + Intergenic
1119897540 14:78232666-78232688 AGGGGATAGGGAAGAGAAGCAGG - Intergenic
1122599912 14:102916044-102916066 AGGCAAGAGGCAGGAGAGGAGGG - Intergenic
1124412860 15:29451285-29451307 AGGCGAGAGGCGAGGGCCGAGGG - Intronic
1125957596 15:43800895-43800917 AGGCAATAGGGTAGAGCCGAGGG + Intronic
1127364873 15:58279398-58279420 AGGGGATAGCCAAGAAACAAAGG - Intronic
1128724864 15:69981039-69981061 AGGAGCTAGGCAAAAGACAATGG - Intergenic
1129062976 15:72875139-72875161 AGACAATAGGCCAGACACGATGG - Intergenic
1139551267 16:67674349-67674371 AGGGAACAGGCAGGAGACGAGGG + Intergenic
1142470478 17:160710-160732 AGGCCATAGACAAGGGAGGATGG + Intronic
1146676339 17:34776070-34776092 AAGAGAGAGGCAAGAGACTAAGG - Intergenic
1147264873 17:39228475-39228497 AGGCTATAGGCCAGACACGGTGG - Intergenic
1150636706 17:66918324-66918346 AGCCGATAGGCAAGAGTCCAAGG - Intergenic
1154327338 18:13401024-13401046 AGGAGATGGGCAAGAGATGGGGG + Intronic
1162395616 19:10416789-10416811 AGGCAATAGGCAAGTGGCGGGGG + Intronic
1164430598 19:28185126-28185148 AGGGGAATGGCAAGAGATGAGGG + Intergenic
1166434514 19:42755949-42755971 AGGCGACAGGCAAGAGCTGGTGG + Intronic
1166464076 19:43016728-43016750 AGGGGATAGGCAAGAGCTGGTGG + Intronic
1166470230 19:43073311-43073333 AGGGGATAGGCAAGAGCTGGTGG + Intronic
1166490946 19:43259818-43259840 AGGCGACAGGCAAGAGCTGGTGG + Intronic
1168258474 19:55179861-55179883 AGGCGATAGGGAAGAGAGACAGG - Intronic
925397727 2:3548225-3548247 AGGGGAAAGGGAAGAGAGGAGGG - Intronic
925656455 2:6155220-6155242 GGGCGAGAGGCAATAGATGAAGG + Intergenic
928399504 2:30967659-30967681 AGGCCATGGGCATGAGAGGAGGG - Intronic
930896450 2:56452059-56452081 AGTGGACAGGCAAGAGAAGAGGG + Intergenic
938701326 2:133882778-133882800 AGAGGATAGGGAAGAGAGGATGG + Intergenic
939944122 2:148388010-148388032 ATGGAATAGCCAAGAGACGAGGG + Intronic
940275511 2:151936619-151936641 AGGTGATAGGCAAATGACCAAGG - Intronic
1173140396 20:40476846-40476868 AGGCGATAAGGAAGAGAGGTAGG + Intergenic
1175988781 20:62777321-62777343 AGGGGATAGGACAGAAACGAGGG + Intergenic
1181335115 22:22123411-22123433 AGGCAATAGGAAAAAGACGGTGG - Intergenic
1181380253 22:22496677-22496699 AAGTGATAGGCAAGGGAAGATGG + Intronic
1181680866 22:24495067-24495089 AGGCGAAGGGCAAGGGGCGAAGG + Exonic
1185082506 22:48717810-48717832 AGGGCATAGGCAAGGGAAGAGGG + Intronic
951330632 3:21364279-21364301 AGGTGACAGGAAAGAGAAGAGGG - Intergenic
953227682 3:41035398-41035420 AGGCAAAAGGCAAGAGGCAAGGG - Intergenic
958134953 3:89476907-89476929 AGGGGAAAGGGAAGAGACAAAGG + Intronic
961434278 3:126905910-126905932 ACGCGAGAACCAAGAGACGAGGG + Intronic
961548560 3:127652977-127652999 AGGGGAGAGGCAAGAGGAGAGGG - Intronic
974522163 4:62995928-62995950 AGAAAATAGGCAAGAGAGGAAGG + Intergenic
975714042 4:77188605-77188627 AGGCGGTAGGCGAGAAATGAGGG + Intronic
976777178 4:88719557-88719579 AGGAGAAAGGAAAGAGAAGAAGG - Intergenic
980945431 4:139315230-139315252 AGGAAATAGGCCAGGGACGATGG + Intronic
981027163 4:140088316-140088338 AGGGGATAGGGGAGAGAGGAGGG - Intronic
988485608 5:31665922-31665944 AGGTGATAGGGAAGTGAGGACGG + Intronic
999317182 5:150591528-150591550 AGGCGAAGGCCAAGAGACCAGGG - Intergenic
1000890281 5:166793560-166793582 AGGAGAAAGGCAAGAGTGGACGG + Intergenic
1001885539 5:175287143-175287165 AGGGGACAGGAAAGTGACGAAGG - Intergenic
1003691791 6:8362071-8362093 AGGCAGCAGGCAAGAGAAGATGG - Intergenic
1005210256 6:23452490-23452512 AGGAGAATGGCAGGAGACGAAGG - Intergenic
1011356877 6:86480336-86480358 AGGCGATTGGTAAGAGACTGAGG - Intergenic
1012654929 6:101805517-101805539 AGGCAATAGGCATGAGAAGAGGG - Intronic
1015642790 6:135354682-135354704 AGGCGATAAGCAAGTGCAGAGGG + Intronic
1016427037 6:143945843-143945865 AGGCGAGAGGCAAGAAATGCTGG + Intronic
1019333452 7:471599-471621 AGGTGATAGGGAAGAGAGGGTGG - Intergenic
1025957369 7:66193257-66193279 AGGAGATAGGGAAGAAAGGAGGG + Intergenic
1026537678 7:71253532-71253554 AGGCAGTAAGGAAGAGACGAAGG - Intronic
1026826876 7:73587919-73587941 AGGGGAGAGGGAAGAGAGGAGGG + Intergenic
1027750095 7:82132541-82132563 AGGAGAGAGGCAAGTGACAATGG - Intronic
1031642548 7:124182229-124182251 GGGAGATAGGCAAGAGAGAAGGG + Intergenic
1035264864 7:157685077-157685099 AGGCGAGAGGCGAGGGGCGAGGG - Intronic
1041028985 8:53717065-53717087 AGGCGATAGGCAAGAGACGATGG - Intronic
1044161069 8:88915725-88915747 AGGCCATAGGCAAGAGAATGCGG + Intergenic
1044559885 8:93602476-93602498 AGGCGATATGCAAGATGAGATGG + Intergenic
1045161980 8:99558348-99558370 AGGAGCTAGGCAAGTGAAGAGGG - Intronic
1047101988 8:121687362-121687384 TGCAGATAGGCAAGAGAAGATGG + Intergenic
1049870513 8:144971706-144971728 AGGGGAAAGGAAAGAGAGGAAGG - Intergenic
1050135371 9:2457849-2457871 GGGAGATAGGAAAGAGAAGAGGG + Intergenic
1052817374 9:33112047-33112069 AGGGGACAGGCAAGAGGCAAAGG + Exonic
1053010897 9:34632564-34632586 AGTCTATAGGCAAGAGATGATGG + Intergenic
1058054252 9:100433723-100433745 AGGAGACAGGCAAGATACTAGGG + Intronic
1059549515 9:115214940-115214962 AGGGGATAGAAAAGAGAGGAGGG - Intronic
1061262204 9:129486640-129486662 AGGCCAAAGGCAAGAGACCTGGG - Intergenic
1061924300 9:133798407-133798429 AGGCGGTGGGCAGGACACGAGGG - Intronic
1188454022 X:30341177-30341199 AGAGCATAGGCAAGAGATGATGG - Intergenic
1189853118 X:45196450-45196472 AGGAGACAGACAAGAGACAAGGG + Intronic
1195928287 X:110048256-110048278 AAGGGATAGGCAAGAGGAGAAGG - Intronic
1196016276 X:110944051-110944073 AGGAGAAAGGAAAGAGACCAAGG - Intergenic