ID: 1041028986

View in Genome Browser
Species Human (GRCh38)
Location 8:53717078-53717100
Sequence TCACACAGTTGATAGGCGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041028986_1041028991 4 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data
1041028986_1041028995 21 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028995 8:53717122-53717144 TGGGGGCCACCGATGTACACAGG No data
1041028986_1041028988 1 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028988 8:53717102-53717124 CATCGCCAAGAAACCACCTTTGG No data
1041028986_1041028990 3 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028990 8:53717104-53717126 TCGCCAAGAAACCACCTTTGGGG No data
1041028986_1041028989 2 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028989 8:53717103-53717125 ATCGCCAAGAAACCACCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041028986 Original CRISPR TCACACAGTTGATAGGCGAT AGG (reversed) Intronic
901715112 1:11147232-11147254 TTACACAGATGATAGGGGACAGG + Intronic
902694542 1:18131411-18131433 TCACACAGCTTGTAGGCGGTGGG - Intronic
902948126 1:19858348-19858370 TCACATAATTGAGAGGTGATGGG - Intergenic
904227805 1:29038889-29038911 TCACACAGCTGTTAGGACATTGG - Intronic
904300946 1:29554876-29554898 TCACACAGTTGCTGGGTGCTGGG + Intergenic
908222794 1:62025002-62025024 TCACAAAATTGATAGGCTATAGG - Intronic
908452235 1:64267464-64267486 TCCCACAGTTGTTAGGCTACTGG + Intergenic
910158703 1:84250450-84250472 TCACACAGTTGCTTGGAGATTGG - Intergenic
911154448 1:94624701-94624723 TCACACAGTTGGTGGGTGACAGG - Intergenic
911886947 1:103313862-103313884 ACACACAGTTGATAGGCAACAGG + Intergenic
916198918 1:162251168-162251190 TCACACAGCTCATAGGCCACAGG - Intronic
916332756 1:163636489-163636511 TCACAAAGCTGATAGGATATAGG - Intergenic
916574339 1:166053871-166053893 TCACACAGATGATAGGTGAGTGG + Intergenic
924395648 1:243617504-243617526 TCACAGAGTTCATAGGCTAGTGG + Intronic
924620182 1:245653599-245653621 TCACACAGCTAATAGGCAACAGG + Intronic
1063719759 10:8568068-8568090 TCACTCAGCTGATAGGTGAGAGG + Intergenic
1069252308 10:66284354-66284376 TCACATAGTTAATAAGAGATTGG + Intronic
1072205113 10:93196794-93196816 GCACAGAGTTGATAGGAAATTGG - Intergenic
1073625594 10:105092732-105092754 TCACATAGCTAATTGGCGATAGG + Intronic
1073887006 10:108050904-108050926 TCACACAGTTTATTGGCCCTGGG + Intergenic
1074936021 10:118182294-118182316 TCACACAGGTGATTGGGGAAGGG - Intergenic
1076476789 10:130759094-130759116 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476801 10:130759156-130759178 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476808 10:130759187-130759209 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476820 10:130759249-130759271 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476827 10:130759280-130759302 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476852 10:130759404-130759426 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476859 10:130759435-130759457 ATACACAGTTGATAGGGGATGGG + Intergenic
1076476879 10:130759559-130759581 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476891 10:130759621-130759643 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476903 10:130759683-130759705 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476915 10:130759745-130759767 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476927 10:130759807-130759829 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476939 10:130759869-130759891 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476946 10:130759900-130759922 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476958 10:130759962-130759984 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476965 10:130759993-130760015 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476990 10:130760117-130760139 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076476997 10:130760148-130760170 ATACACAGTTGATAGGGGATGGG + Intergenic
1076477017 10:130760272-130760294 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477029 10:130760334-130760356 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477041 10:130760396-130760418 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477053 10:130760458-130760480 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477065 10:130760520-130760542 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477072 10:130760551-130760573 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477097 10:130760675-130760697 ATGCACAGTTGATAGGGGATGGG + Intergenic
1076477104 10:130760706-130760728 ATACACAGTTGATAGGGGATGGG + Intergenic
1081662439 11:44896312-44896334 TCACACTGTTGGTAAGTGATGGG - Intronic
1081941453 11:46945788-46945810 TTACACAGTAGATGGGAGATGGG + Intronic
1081944038 11:46972966-46972988 TCACACAGTTGTTAAGTGGTAGG - Intronic
1084287648 11:68142361-68142383 TCACACAGTTGGGAGGTGGTGGG + Intergenic
1085991610 11:81853596-81853618 TCACATAGTTTATAGGGCATTGG + Intergenic
1087833406 11:102844942-102844964 CCACACAGTTGATAGCCACTTGG + Intergenic
1089281133 11:117375295-117375317 TCACACAGCTGATAAGCAAGGGG - Intronic
1091918232 12:4284339-4284361 TCACACACTTGGTAGGTGGTGGG + Intronic
1097395796 12:59073199-59073221 TCACACAGTTGGTAGGCACCAGG - Intergenic
1102427353 12:112854534-112854556 TCACACAGTTAATAAGTGGTGGG + Intronic
1107670105 13:42736624-42736646 TTACACAGCTCATAAGCGATGGG + Intergenic
1110141925 13:72140611-72140633 TCTCACAGCTGATAGGGAATGGG - Intergenic
1113116127 13:106876443-106876465 TCACAGAGCTTATAGGTGATTGG + Intergenic
1113262026 13:108575478-108575500 TCACACAGTTAATGGGTGCTGGG - Intergenic
1113817197 13:113181067-113181089 TCACAAAGTTGACAGCTGATAGG - Intronic
1121440641 14:93946961-93946983 TCACACAGCTCATAGGCGGCAGG - Intronic
1122943473 14:104994034-104994056 GCACACAGGTGACAGGCGACAGG + Intronic
1124401518 15:29352556-29352578 TCAGACAGGTGACAGGCGAGCGG - Intronic
1124795953 15:32780024-32780046 TCACACAGTTAATAAGTGATAGG - Intronic
1130608729 15:85341126-85341148 TCACACAGTTAATAGATGATAGG - Intergenic
1138057035 16:53846018-53846040 TCACAAAGCTGACAGGAGATTGG - Intronic
1138237714 16:55399055-55399077 AGACACAGTTGAAAGGTGATTGG - Intronic
1140827360 16:78719121-78719143 TCACACAGATGATACATGATGGG - Intronic
1141598674 16:85112477-85112499 CCACCCGGTTGCTAGGCGATGGG + Exonic
1143782339 17:9235687-9235709 TCACACAGTGGAAAGGGCATGGG + Intronic
1146257597 17:31400596-31400618 TCACCCAGGTGATGGGCGCTGGG + Intronic
1151251484 17:72839110-72839132 TGACACAGCTGATAGCCCATGGG + Intronic
1154343027 18:13520124-13520146 TCACACACTTGTTAGGGGATTGG + Intronic
1157142503 18:45123970-45123992 TCACACAGATTATAAGTGATGGG + Intergenic
1160095353 18:75866730-75866752 TCTCACAGATGACAGGCAATGGG - Intergenic
1168074023 19:53969371-53969393 TCACACAGTTAATATGCAGTAGG + Intronic
1168666103 19:58206313-58206335 TCCCTCAGTTGATAGACAATGGG + Intronic
925785764 2:7430534-7430556 ACACACAGTTGATTAGTGATAGG + Intergenic
926644403 2:15273685-15273707 CCACACAGCTGATAAGTGATAGG + Intronic
927759358 2:25738461-25738483 GCACACAGTTGTAAGGAGATGGG + Intronic
929029502 2:37637281-37637303 ACACACAGATGAAAGGCCATGGG - Intergenic
930195091 2:48501548-48501570 TCACACACTTGATAAGTGATGGG + Intronic
935125823 2:100221934-100221956 TCACCCAGGTGAGAGGCTATGGG - Intergenic
935701559 2:105816586-105816608 GCACACAGTTGAGAGGTGACTGG - Exonic
937473395 2:122192618-122192640 TCACATAGCTGATAAGTGATGGG + Intergenic
938743294 2:134253080-134253102 TTACTCTGTTGATAGGCAATGGG + Intronic
942008150 2:171730248-171730270 TCACAGAGTTGATGGGAAATAGG + Intronic
1172179343 20:32991461-32991483 TCACACAGCTTATAGGTGGTGGG + Intronic
1175797543 20:61781634-61781656 TCACACAGATGTTAGGCCACTGG - Intronic
1177014396 21:15767053-15767075 TCACTTAGTTAATAGGTGATGGG + Intronic
1179531601 21:42023192-42023214 TCACACAGTTGATCGCCGGCGGG - Intergenic
1181911307 22:26240388-26240410 TCACACAGTTGACAAGGAATAGG - Intronic
1182032367 22:27169374-27169396 TCCCACAGCTGATGGGGGATGGG - Intergenic
1182051352 22:27315186-27315208 TCACACAGTTGGAAGGTGGTGGG - Intergenic
1183547150 22:38460392-38460414 TCACTCAGGTGATAGGAGAGGGG + Intergenic
1185132563 22:49047450-49047472 TCACACAGTGGACAGTCCATAGG + Intergenic
949489903 3:4579127-4579149 TCACACAGCTGATGAGCTATGGG - Intronic
955304078 3:57811972-57811994 TCATACATTTGATAAGGGATTGG - Intronic
955490824 3:59480433-59480455 TCACACAGTTGGTGGGGGCTGGG + Intergenic
956628858 3:71294486-71294508 TCACAGAGTTGATAGTCTAGAGG - Intronic
959120554 3:102227146-102227168 TCACACAGCTGGTAAGAGATTGG - Intronic
960061631 3:113328898-113328920 TCACAAAGCTTATAGGCTATTGG - Intronic
960102228 3:113756146-113756168 TCACACAGTTTATAAGTGGTAGG + Intronic
961098769 3:124180542-124180564 TCACACAGCTGATAAGTGGTGGG - Intronic
962109517 3:132429396-132429418 TAACACAGCTGGTAAGCGATTGG - Intronic
964192442 3:154019109-154019131 TCAGAAAGTTGATAAGGGATGGG + Intergenic
965175756 3:165330200-165330222 TCACACAGTGGAAAGGCAAAGGG + Intergenic
966726682 3:183115053-183115075 TAACACAGTTGGTAGGAGAGAGG - Intronic
968024209 3:195425452-195425474 GCACACAGTAGATAGGCAACAGG - Intronic
969312380 4:6361419-6361441 TCACACAGATGTTAGGCAGTGGG - Intronic
976817504 4:89166248-89166270 TTACACATTTGATAAGTGATGGG + Intergenic
977741788 4:100492882-100492904 TCACATAGCTGATAAGTGATGGG - Intronic
978109736 4:104948209-104948231 TCACACATTTAATAAGCCATAGG - Intergenic
981634860 4:146865040-146865062 TCACACAGTTAATAGGTTGTAGG + Intronic
982637328 4:157913578-157913600 CTACACAGTTCATAGGCCATAGG + Intergenic
984504952 4:180605546-180605568 TCACACAGTTAATATGCAATAGG - Intergenic
986691777 5:10319277-10319299 ACACACATTTGATAAGCTATGGG + Intergenic
987566587 5:19596048-19596070 TCTCACAGTTGATTGGTGAAGGG + Intronic
992734769 5:79707946-79707968 TCACACAGTGGATGGGCAAAAGG + Intronic
995693922 5:114858428-114858450 ACACAGAGTTGAGAGGTGATTGG + Intergenic
996624120 5:125549378-125549400 TGACACACTTGATAGGTGACAGG + Intergenic
996710521 5:126538731-126538753 TCACACAGCTGATAAATGATGGG - Intergenic
998663440 5:144267239-144267261 TCACACAGTTCATATACGGTGGG - Intronic
999661838 5:153872510-153872532 TCATATAGTTGATAAGCAATAGG + Intergenic
1002057352 5:176606103-176606125 TCACAGAGCTGATAAGCGGTGGG - Intronic
1002333705 5:178463645-178463667 TCACACAGCTGAGAGGCGAGCGG + Intronic
1006809175 6:36808884-36808906 TCACACAGCTAGCAGGCGATAGG + Intronic
1015131961 6:129821371-129821393 TCACACAGTTATTAAGAGATAGG + Intergenic
1021407720 7:20292480-20292502 TATCACAGTTGATAGGAGGTGGG + Intergenic
1027900089 7:84102166-84102188 TCACACAGTTGATTGGTGATAGG - Intronic
1031712142 7:125061930-125061952 TCACACAGCTAATAGGCCATGGG + Intergenic
1038908198 8:31931403-31931425 TCACACAGTTAGTAGGTGATGGG - Intronic
1041028986 8:53717078-53717100 TCACACAGTTGATAGGCGATAGG - Intronic
1043293776 8:78638564-78638586 TCATACAGCTGAGAGGAGATAGG + Intergenic
1044813825 8:96090486-96090508 TCATACAGTTGATAGGTGACAGG + Intergenic
1045853686 8:106736123-106736145 TAACAAAATTGATAGGCAATGGG + Intronic
1047642522 8:126835548-126835570 TCAAACAGTTAATAAGTGATGGG - Intergenic
1049958317 9:713373-713395 TGACAGAGTTGATAGACGACAGG - Exonic
1050469193 9:5967711-5967733 ACACACATTTCATAAGCGATGGG + Intronic
1058824896 9:108766432-108766454 TAACACAGTTGAAAAGCGAAGGG + Intergenic
1060151055 9:121288626-121288648 TCACATAGATGATAGTTGATAGG + Intronic
1060840569 9:126789974-126789996 TCACACAGCTGGTAAGTGATGGG - Intergenic
1061721436 9:132554096-132554118 TCACACAGCTGGAAAGCGATAGG + Intronic
1192549186 X:72040352-72040374 TCACACAGTTAATAAGTGTTAGG - Intergenic
1195598570 X:106720718-106720740 TCACACAGCTGGTAGGTGGTGGG - Intronic
1199468290 X:148165079-148165101 TCACACAGTTCAGAGAGGATGGG + Intergenic
1200983985 Y:9287245-9287267 TAACACAGATGAAAGGCGAAGGG - Intergenic
1201696585 Y:16833344-16833366 TAACACAGATGAAAGGCGAAAGG + Intergenic