ID: 1041028987

View in Genome Browser
Species Human (GRCh38)
Location 8:53717085-53717107
Sequence GCGATGCTCACACAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041028987_1041028990 -4 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028990 8:53717104-53717126 TCGCCAAGAAACCACCTTTGGGG No data
1041028987_1041028989 -5 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028989 8:53717103-53717125 ATCGCCAAGAAACCACCTTTGGG No data
1041028987_1041028988 -6 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028988 8:53717102-53717124 CATCGCCAAGAAACCACCTTTGG No data
1041028987_1041028991 -3 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data
1041028987_1041028995 14 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028995 8:53717122-53717144 TGGGGGCCACCGATGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041028987 Original CRISPR GCGATGCTCACACAGTTGAT AGG (reversed) Intronic
907705962 1:56832976-56832998 GTGATGCTCATACAATTGATTGG - Intergenic
909888011 1:80966573-80966595 GCTATGGTCACACAGCTTATAGG + Intergenic
912332219 1:108830295-108830317 GCGATGCTGAGACAGTAGGTGGG + Intronic
913683989 1:121214370-121214392 GCCAAGGTCACACAGTTAATAGG + Intronic
918524457 1:185450626-185450648 GCTATGGTCACACAGTTGTAAGG - Intergenic
920471294 1:206232862-206232884 GCCAAGGTCACACAGTTAATAGG + Intronic
920832096 1:209474762-209474784 GCCAAGATCACACAGTTAATAGG + Intergenic
923263384 1:232288774-232288796 GCCAGGCACACAGAGTTGATTGG - Intergenic
1069832240 10:71288553-71288575 GCCATGCTCTTACAGTCGATGGG + Exonic
1073887004 10:108050897-108050919 GCAAAGCTCACACAGTTTATTGG + Intergenic
1076384574 10:130047147-130047169 GCCAGGCTCACACAGGGGATTGG - Intergenic
1081464208 11:43301273-43301295 GCAATGCTCTCACAGTTCTTGGG - Intergenic
1082998630 11:59272403-59272425 GAGAGGCTCACAGAGTTGAAGGG + Intergenic
1084824789 11:71722022-71722044 GCACTCCTCACACAGTTCATGGG - Intergenic
1087365104 11:97208766-97208788 GGGATGCTGACACAGAGGATGGG - Intergenic
1102641235 12:114368711-114368733 GAGATGTTCACACACTTGAGGGG - Intronic
1105606088 13:21927584-21927606 GGGATGCTCACACAGAGGAAAGG + Intergenic
1107860755 13:44658901-44658923 GCATTGCTCACTCACTTGATGGG + Intergenic
1120177087 14:81306054-81306076 GGGCTGCTCACAGAGTTGAAGGG - Intronic
1202851738 14_GL000225v1_random:24631-24653 GCACTGATCACACAGGTGATGGG + Intergenic
1202861300 14_GL000225v1_random:83658-83680 GCAATGATCACCCAGCTGATGGG + Intergenic
1126582717 15:50255939-50255961 GTGATGCTCAGAGAGGTGATGGG + Intronic
1126788262 15:52196957-52196979 CCCAGGCTCACACAGTGGATTGG - Intronic
1136518988 16:30784402-30784424 ACGATGCTCACAGAGGTGAGGGG - Exonic
1141378948 16:83558056-83558078 GCAATGCTCACACAGTCTACAGG + Intronic
1147987153 17:44313193-44313215 ATGCTGCTCACACAGTTGTTGGG - Exonic
1154462061 18:14601294-14601316 GTGATGCTCACACATACGATGGG + Intergenic
1157367588 18:47079979-47080001 TGGATGCTCACACCATTGATGGG - Intronic
1163478658 19:17541562-17541584 GCGATGCTGGCACAATTGAGAGG - Intronic
1167856173 19:52242176-52242198 GCTATCCTCACAGAGTTGGTAGG - Intergenic
928178510 2:29051362-29051384 CTCATGCTGACACAGTTGATGGG + Intronic
948014731 2:234678756-234678778 GAGATGCTCTCACAGCTGACTGG + Intergenic
1168885434 20:1249476-1249498 GCTATGCTCACAAAGTTGTCAGG + Intronic
1173482874 20:43416839-43416861 GTTATGGTCACACAGTTGCTTGG - Intergenic
1176812499 21:13557336-13557358 GTGATGCTCACACATGCGATGGG - Intergenic
1182892191 22:33828274-33828296 GAGACGCTGACACAGGTGATTGG + Intronic
950904144 3:16522278-16522300 GGGAAGCTCACAGAATTGATGGG + Intergenic
953536629 3:43782006-43782028 CAGATCCTCACACAGTGGATGGG - Intergenic
961895999 3:130168072-130168094 GCACTCCTCACACAGTTCATGGG + Intergenic
964205295 3:154167968-154167990 CTAATGATCACACAGTTGATAGG - Intronic
969746769 4:9078894-9078916 GCACTCCTCACACAGTTCATGGG - Intergenic
984418108 4:179486440-179486462 GCCATGCTCACAGAGTTCACTGG - Intergenic
985814162 5:2114382-2114404 GCGATCCTTACACAGATGACTGG - Intergenic
988853357 5:35200848-35200870 GCGAAGATCACACAGATGAACGG + Intronic
990521624 5:56586910-56586932 GAGGTGCTCACACAGTTTAGCGG - Intronic
998497628 5:142604520-142604542 CCGATGATCACACAGCTAATAGG - Intronic
1008066732 6:47058035-47058057 GCTATGCTCAGGCATTTGATAGG - Intergenic
1010609333 6:77934085-77934107 GCTTGACTCACACAGTTGATTGG + Intergenic
1015047578 6:128794854-128794876 GGGATGCTTATACTGTTGATGGG + Intergenic
1023226403 7:37974026-37974048 GCTAAGCTCACACAGTTCAAAGG - Intronic
1026237619 7:68541535-68541557 GGGATGCTTACACAGTTGGTGGG - Intergenic
1033200020 7:139360286-139360308 GCGATGCTGGACCAGTTGATGGG + Exonic
1034461292 7:151199425-151199447 GCTGAGCTCACACTGTTGATAGG + Intronic
1039920992 8:41894748-41894770 GCGATGCTCACCCACTTTCTTGG - Intronic
1041028987 8:53717085-53717107 GCGATGCTCACACAGTTGATAGG - Intronic
1044656397 8:94553233-94553255 GCGATGCTCACACAGCTCGGGGG + Intronic
1046091475 8:109507835-109507857 GCGATGCTCACATTCTTGAATGG + Exonic
1060329479 9:122653354-122653376 CCAAAGATCACACAGTTGATGGG - Intergenic
1061174814 9:128988450-128988472 CCCAAGGTCACACAGTTGATTGG - Intronic
1197867468 X:131034499-131034521 GCCATGTTCAGACAGGTGATCGG + Intergenic
1201070591 Y:10144361-10144383 GCACTGATCACCCAGTTGATGGG - Intergenic