ID: 1041028991

View in Genome Browser
Species Human (GRCh38)
Location 8:53717105-53717127
Sequence CGCCAAGAAACCACCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041028987_1041028991 -3 Left 1041028987 8:53717085-53717107 CCTATCAACTGTGTGAGCATCGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data
1041028986_1041028991 4 Left 1041028986 8:53717078-53717100 CCTATCGCCTATCAACTGTGTGA 0: 1
1: 0
2: 1
3: 16
4: 132
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data
1041028985_1041028991 17 Left 1041028985 8:53717065-53717087 CCATCGTCTCTTGCCTATCGCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041028991 Original CRISPR CGCCAAGAAACCACCTTTGG GGG Intronic
No off target data available for this crispr