ID: 1041030860

View in Genome Browser
Species Human (GRCh38)
Location 8:53733997-53734019
Sequence CTGTTAAGGCCCTCAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 21, 3: 68, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041030860_1041030866 21 Left 1041030860 8:53733997-53734019 CCCATGTTTGAGGGCCTTAACAG 0: 1
1: 1
2: 21
3: 68
4: 129
Right 1041030866 8:53734041-53734063 AAGCAGATAAACTGACTCTTGGG No data
1041030860_1041030865 20 Left 1041030860 8:53733997-53734019 CCCATGTTTGAGGGCCTTAACAG 0: 1
1: 1
2: 21
3: 68
4: 129
Right 1041030865 8:53734040-53734062 AAAGCAGATAAACTGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041030860 Original CRISPR CTGTTAAGGCCCTCAAACAT GGG (reversed) Intronic
902173765 1:14633996-14634018 CTATTGAGACCCTCAAACACAGG - Intronic
902986551 1:20157871-20157893 CTGCCAAGGTCCTCAAACATGGG - Intergenic
903620395 1:24693959-24693981 CTGTAATTGCCCTTAAACATTGG + Intergenic
905405018 1:37726731-37726753 CTCTTGAGGCCCTCGAACACAGG - Intronic
905849224 1:41260628-41260650 CTATTCAGGCCCTCAAGGATTGG - Intergenic
912816175 1:112830431-112830453 CTGCCAAGGCCCTCAAACATGGG - Intergenic
913249374 1:116899712-116899734 CTGTTAAGACACTGAAATATGGG - Intergenic
915880801 1:159668931-159668953 CTCTTCAGGCCCTCAGCCATAGG - Intergenic
917535465 1:175871539-175871561 CTGTGAAGGCCCCCAACCAAGGG - Intergenic
918670940 1:187216034-187216056 CTATTCAGGCCCTCAAAAATTGG - Intergenic
922556554 1:226536935-226536957 CATTTAAGGCCCCCAAACAAAGG + Intergenic
923111158 1:230891407-230891429 CTGTAAAAGCCCCCAAAAATAGG - Intergenic
1062826088 10:569969-569991 CTGATAGGACCCTAAAACATGGG - Intronic
1064400199 10:15014712-15014734 CTGCCAAGGCCCTCAAACATGGG + Intergenic
1064681295 10:17812933-17812955 CTGGGAAGGCGCTCAAACAGTGG + Intronic
1066096063 10:32072942-32072964 CTCTTAAGGTCCCCAAACCTGGG + Intergenic
1066390325 10:34972912-34972934 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1067020890 10:42796680-42796702 CTGTTAAGGGCATCAAACGACGG + Exonic
1070904896 10:80063360-80063382 CTCTTAAGGCCCTCAGCCATAGG - Intergenic
1071794354 10:88989641-88989663 CTGTTTGGGCCCTCAAATCTAGG - Intronic
1076398767 10:130162905-130162927 CTGAAAAGGCCCTCCAAGATTGG - Intronic
1077589100 11:3478104-3478126 CTGCCAAGGCCCTCAAACACGGG + Intergenic
1077749121 11:4944134-4944156 CAGTTATGCACCTCAAACATAGG + Intronic
1082846069 11:57726573-57726595 CTCTTAAGGCCCTCAGCCATAGG + Intronic
1084227792 11:67728228-67728250 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1084244793 11:67849727-67849749 CTGCCAAGGCCCTCAAACATGGG + Intergenic
1084261195 11:67979910-67979932 CTGCCAAGGCCCTCCAACACAGG + Intergenic
1084807436 11:71588638-71588660 CTGCCAAGGCCCTCCAACAGGGG - Intronic
1084811461 11:71614187-71614209 CTGCCAAGGCCCCCAAACACAGG - Intergenic
1084827892 11:71744829-71744851 CTGCCAAGGCCCTCAAACACGGG - Intergenic
1084844527 11:71888646-71888668 CTGCCAAGGCCCTCCAACAGGGG - Intronic
1084847380 11:71911102-71911124 CTGCCAAGGCCCTCCAACAGGGG - Intronic
1085998888 11:81954982-81955004 CTGCCAGGGCCCTTAAACATGGG - Intergenic
1087894963 11:103576820-103576842 CTGCCAAGGCCCTCAAACATTGG - Intergenic
1091262866 11:134247591-134247613 CTCTTAAGGTCCCCAAACCTGGG + Exonic
1091814371 12:3425334-3425356 CTGGCAAGGCCCTCAAACATGGG + Intronic
1092415363 12:8286874-8286896 CTGCCAAGGCCCTTAAACACGGG + Intergenic
1092432472 12:8420478-8420500 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1092538963 12:9407801-9407823 CTGCCAAGGCCCTCCAACAGGGG - Intergenic
1092556463 12:9567119-9567141 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1092556774 12:9568687-9568709 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1093289222 12:17301033-17301055 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1094515193 12:31121632-31121654 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
1094515629 12:31123521-31123543 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
1095526447 12:43131491-43131513 CTGTTGAGGCTCTGAAACTTGGG - Intergenic
1096509082 12:52117439-52117461 CTGCCAAGGCCCTCAAACACAGG + Intergenic
1098310752 12:69146617-69146639 CTCTTAAGGCCCTCAACCATAGG + Intergenic
1100711249 12:97259306-97259328 CTGTTCAATCCCTCAAATATTGG - Intergenic
1103155862 12:118684426-118684448 CTGTTGAGGGCCTCACAGATTGG + Intergenic
1106701727 13:32235859-32235881 CTGTTGAGGCTCTTAGACATAGG + Intronic
1106854335 13:33832159-33832181 ATGTTAAGGCCCACTAACTTTGG + Intronic
1107490592 13:40877209-40877231 CTGCTAAGGCCCTCAAACCCGGG + Intergenic
1107544245 13:41422039-41422061 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1107940672 13:45378160-45378182 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1107941261 13:45380703-45380725 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1107941858 13:45382720-45382742 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1108053761 13:46467101-46467123 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
1108634825 13:52322969-52322991 CTGTTAATGTCCTTAAAAATAGG - Intergenic
1108648629 13:52454446-52454468 CTGTGGAGGCCCTCAGACCTGGG + Intergenic
1108652979 13:52500219-52500241 CTGTTAATGTCCTTAAAAATAGG + Intergenic
1109537239 13:63737835-63737857 CTGCCAAGGCCCTCAAACATGGG + Intergenic
1109537371 13:63738502-63738524 CTGCCATGGCCCTCAAACAGGGG + Intergenic
1109537810 13:63740396-63740418 CTGCCACGGCCCTCAAACAGGGG + Intergenic
1109546007 13:63839574-63839596 CTGCCACGGCCCTCAAACAGGGG - Intergenic
1109546621 13:63842011-63842033 CTGCCAAGGCCCTCAATCAGGGG - Intergenic
1109546870 13:63843073-63843095 CTGCCATGGCCCTCAAACAGGGG - Intergenic
1109546997 13:63843740-63843762 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
1110891759 13:80705281-80705303 CTGCCACGGCCCTCAAACAAAGG - Intergenic
1112725320 13:102297262-102297284 CTGTTCAGGCCATCAAAAACAGG + Intronic
1115717953 14:36126553-36126575 ATCTTAAAGTCCTCAAACATGGG - Intergenic
1117038728 14:51751210-51751232 CTGCCAAGGCCCTCAAACACAGG - Intergenic
1118199291 14:63657440-63657462 ATTTTAAGGCACTAAAACATTGG - Intergenic
1121938887 14:98048788-98048810 CTGCTGAGACCCTCAAAGATAGG + Intergenic
1129078631 15:73020058-73020080 CTGGTAAGGCCCTGAAAAACAGG - Intergenic
1130181381 15:81632202-81632224 CTGTTAAGGTCCTTGAACACAGG + Intergenic
1135185650 16:20313636-20313658 CTAATAAAGCCATCAAACATTGG + Intronic
1135232342 16:20720606-20720628 ATGTTAAGGCCCTTAAACTAGGG - Intronic
1136294584 16:29294420-29294442 CTGTCAAGGTCCTCAAAAATAGG - Intergenic
1142100489 16:88268464-88268486 CTGTCAAGGTCCTCAAAAATAGG - Intergenic
1144239636 17:13297654-13297676 TTTTTAAGTCCCTCAAACCTGGG - Intergenic
1145864922 17:28235079-28235101 GTGCCAAGGCCCTCAAACATGGG + Intergenic
1149076054 17:52596935-52596957 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1151784257 17:76267423-76267445 CTGCTAAGGCACTCAGACTTGGG - Intronic
1153136335 18:1921525-1921547 CTCTAAAGGCCCTCAGCCATAGG - Intergenic
1153157007 18:2161300-2161322 CTCTTAAGGCCCTCGGCCATAGG + Intergenic
1156195011 18:34764852-34764874 CTGTTATGGACCATAAACATGGG + Intronic
1158655174 18:59324352-59324374 CTATTCAGGCCCTCACAGATTGG - Intergenic
1159295519 18:66481790-66481812 CTCTTAAGGCCTTCAACCAATGG + Intergenic
1163916720 19:20246524-20246546 CTGCTAAGGCTCTCAAACACGGG - Intergenic
1163966436 19:20751371-20751393 CTGCCAAGGCCCTCAAACACGGG + Intronic
1164130518 19:22357454-22357476 CTGCCAAGGCCCTCAAACATGGG + Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1168612615 19:57813513-57813535 CTCTCAAGGTCCTCAAACATAGG + Intronic
1168616188 19:57838908-57838930 CTCTCAAGGTCCTCAAACATAGG - Intronic
1168620683 19:57877135-57877157 CTCTCAAGGTCCTCAAACATAGG + Intronic
930518472 2:52434941-52434963 CTGCCAAGGCCCTCAAACACGGG - Intergenic
931698462 2:64889798-64889820 CTGCCAAGGCCCTCAAACACGGG + Intergenic
932349866 2:71023024-71023046 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
932353361 2:71049154-71049176 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
935112761 2:100107077-100107099 CTGTTTGGGGCCTCTAACATGGG + Intronic
936838027 2:116731816-116731838 CAGTAAAGGCTCTGAAACATGGG - Intergenic
938740072 2:134222729-134222751 CTCTTAAAGCCCTCAGCCATAGG - Intronic
939263994 2:139848628-139848650 CTATTAAGTACCTCAGACATTGG - Intergenic
940869442 2:158847802-158847824 CTGCCAAGGCCCTCAAACAGGGG - Intronic
940872117 2:158868799-158868821 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
941620110 2:167768055-167768077 CTATTCAGGCCCTCAAGTATGGG + Intergenic
942269093 2:174256355-174256377 CTGTTAAGCCCCTCAAATTCTGG - Intergenic
943408248 2:187515148-187515170 CTGCCAAAGCCCTCAAACATGGG - Intronic
947594919 2:231404946-231404968 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1171408476 20:24929663-24929685 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1173573186 20:44091435-44091457 TTTTTAAGGGCCTGAAACATTGG + Intergenic
1173794347 20:45848584-45848606 CTGTGAAGGCCGTGCAACATGGG - Exonic
1177297109 21:19189535-19189557 CTGTTAAGTCCATAAAAGATGGG + Intergenic
1180248519 21:46564162-46564184 CTGTCAGTGCCCTCAAACCTAGG - Intronic
1184023164 22:41834050-41834072 CTGTTAAGGCGCTGGAACAAAGG - Intronic
949158038 3:850546-850568 CAGCCAAGGCCCTCAAACATGGG - Intergenic
949882971 3:8675978-8676000 CTGCCAAGGCCCTCAAACGGGGG - Intronic
949883333 3:8677702-8677724 CTGCCAAGGCCCTAAAACAGGGG - Intronic
949883959 3:8680197-8680219 CTGCCAAGGCCCTCAAACGGGGG - Intronic
949884471 3:8682384-8682406 CTGCCAAGGCCCTCAAACAGGGG - Intronic
951181233 3:19661443-19661465 TTGTTAAGGCCATCAACTATGGG - Intergenic
951391151 3:22105711-22105733 CTATTAAGGTCCTCAATGATTGG + Intronic
951872749 3:27383152-27383174 CAGTCAAGGCCCTAAAATATAGG - Exonic
953882339 3:46697099-46697121 ATGTAAAGTCCCTCAAAGATGGG + Intergenic
956376414 3:68618048-68618070 CTGTCAAGGCCCTCCTCCATGGG + Intergenic
957044474 3:75363293-75363315 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
957076264 3:75605477-75605499 CTGCCAAGGCCCTCAAACACAGG + Intergenic
961272177 3:125697469-125697491 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
961275036 3:125719702-125719724 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
961277953 3:125742333-125742355 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
961876468 3:130027329-130027351 CTTCCAAGGCCCTCAAACAGGGG + Intergenic
961892907 3:130145486-130145508 CTGCCAAGGCCCTTAAACACAGG + Intergenic
962277204 3:134024641-134024663 CTGCTAGGGCCCTTAAACCTGGG - Intronic
963168819 3:142231108-142231130 ATGATTAGGCCCTAAAACATTGG - Intergenic
963228231 3:142884627-142884649 CTGTTAAGGCCATCAACTCTTGG + Intronic
966565442 3:181375624-181375646 TTGTGAAGGCCCTCTAACATGGG - Intergenic
967216567 3:187215645-187215667 CTGTTAAGGTCATCAAAAACGGG - Intergenic
968988738 4:3894534-3894556 CTGCCAAGGCCGTCAAACAGGGG + Intergenic
969025327 4:4168124-4168146 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
969734142 4:8975636-8975658 CTGCCAAGGCCCTCAAACACGGG - Intergenic
969749851 4:9101655-9101677 CTGCCAAGGCCCTCAAACACGGG - Intergenic
974574049 4:63693683-63693705 CTACTAAGGCCATCAAAAATTGG + Intergenic
979936016 4:126697196-126697218 CTGTTTAGACCCTCAAAATTAGG + Intergenic
980073147 4:128264680-128264702 CTGCCAAGGCCCTCAAACACGGG - Intergenic
981604922 4:146530088-146530110 CTGCCAAGGCCCTCAAACATGGG - Intergenic
982662623 4:158225164-158225186 CTGCTAACGCCCTTAGACATGGG + Intronic
982893693 4:160889058-160889080 ATGTTAAGTCCCATAAACATGGG - Intergenic
983248344 4:165315095-165315117 ATGGTAAGACCCTCAAATATGGG + Intronic
988016400 5:25565419-25565441 CTATTCAGGTTCTCAAACATAGG + Intergenic
990184609 5:53200124-53200146 CTCTTAAGGCCCTCAGCCATAGG - Intergenic
993320403 5:86462797-86462819 CTGCTAAGGCCCTCAAACACGGG - Intergenic
993328214 5:86567580-86567602 CTACCAAGGCCCTCAAACATGGG + Intergenic
998492266 5:142557578-142557600 CTGTTAAGGTCATGAAAAATAGG - Intergenic
1002983410 6:2164486-2164508 GGGTTAATGCCCTCAAACAGGGG + Intronic
1007948389 6:45846895-45846917 CTTTTAATTCCCTCAAAAATAGG - Intergenic
1009235505 6:61118715-61118737 CTGCTAAGCCCCTCTAACCTCGG - Intergenic
1010685523 6:78850614-78850636 TTGTTAAGGCACTGAAACTTGGG - Intergenic
1011565277 6:88666364-88666386 GTGCTAAGACCCTCAAACACGGG - Intronic
1012611766 6:101227716-101227738 CTGCCAAGGCCCTCAAATATGGG + Intergenic
1013223382 6:108100195-108100217 CTGTCAAGGTCATCAAAAATAGG + Intronic
1016555849 6:145337055-145337077 TTGTTAAACCCCTCAAAAATAGG - Intergenic
1017879498 6:158550126-158550148 CTATTCACGCCCTCCAACATGGG - Intronic
1020307102 7:6843805-6843827 CTGCCAAGGCCCTCAAACACAGG + Intergenic
1020311581 7:6872647-6872669 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1020323136 7:6954987-6955009 CTACCAAGGCCCTCAAACACGGG + Intergenic
1023941179 7:44769186-44769208 CTGGGAAGGCCCTCAAGGATGGG - Exonic
1026291775 7:69013459-69013481 CTATTTAGGCCCTCAAAGAATGG + Intergenic
1029078255 7:97952749-97952771 CTGCCAAGGCCCTCAAACACAGG + Intergenic
1029486236 7:100843607-100843629 CTGCTAGGGCCCTTAAACCTGGG - Intronic
1030598319 7:111564769-111564791 CGCTTACTGCCCTCAAACATCGG - Intergenic
1032170695 7:129582260-129582282 CTGCTAAGGCCCTCAAACATGGG - Intergenic
1034303351 7:150034217-150034239 CTGCCAAGGCCCTCAAATAGGGG + Intergenic
1034303914 7:150036298-150036320 CTGCCAAGGCCCTCAAATAGGGG + Intergenic
1034304438 7:150038224-150038246 CTGCCAAGGCCCTCAAATAGGGG + Intergenic
1034801234 7:154057926-154057948 CTGCCAAGGCCCTCAAATAGGGG - Intronic
1035597394 8:869542-869564 CTTTAAAAGCTCTCAAACATGGG + Intergenic
1036239748 8:7071753-7071775 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1036262128 8:7249394-7249416 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1036304462 8:7590164-7590186 CTGCCAAGGCCCTCCAACAGGGG - Intergenic
1036314167 8:7707933-7707955 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1036372931 8:8175995-8176017 CTGCCAAGGCCCTCAAACAAGGG - Intergenic
1036816695 8:11907863-11907885 CTGCCAAGGCCCTCAAACACGGG + Intergenic
1036820523 8:11936009-11936031 ATTTTAAGCCCCTCAAACAGTGG + Intergenic
1036833415 8:12039392-12039414 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1036855261 8:12285957-12285979 CTGCCAAGGCCCTCCAACAGGGG + Intergenic
1036877974 8:12489646-12489668 CTGCCAAGGCCCTCAAACAAGGG + Intergenic
1036906073 8:12709490-12709512 CTGCCAAGGCCCTCAAACACGGG + Intergenic
1038799053 8:30732803-30732825 CTGCCAAGGCCCTCAAACATGGG - Intronic
1039023356 8:33231313-33231335 CAGATAAGGCCCTCAGACAAAGG + Intergenic
1039278304 8:35955704-35955726 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1039841524 8:41296737-41296759 CTCTGAAGTCCCTCAAACATAGG + Intronic
1041030860 8:53733997-53734019 CTGTTAAGGCCCTCAAACATGGG - Intronic
1044013130 8:87019328-87019350 CTCTTAAGGCCCTCAGCTATAGG + Intronic
1048957440 8:139548714-139548736 CTGCCAAGGCCCTCAAACATGGG + Intergenic
1049666142 8:143843728-143843750 CTGATAAGGACATCAAACATTGG - Intergenic
1053736943 9:41108088-41108110 CTGCGAAGGCCCTCAAACAGGGG - Intergenic
1054691429 9:68323309-68323331 CTGCGAAGGCCCTCAAACAGGGG + Intergenic
1054962166 9:70980901-70980923 CTTTTCAGGTCCTAAAACATAGG - Intronic
1055332303 9:75197132-75197154 CTATTAATTCCCTCAAACATTGG - Intergenic
1056865766 9:90226258-90226280 CTGCCAAGGCCCTCAAACAGGGG - Intergenic
1056917250 9:90756644-90756666 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1061041042 9:128140615-128140637 CTGCCAAGGCCCTCAAACAGGGG + Intergenic
1062224237 9:135440390-135440412 CTGCCAAGGCCCTCAAACACGGG + Intergenic
1186911191 X:14168303-14168325 CTGATAATCCCATCAAACATGGG - Intergenic
1190480622 X:50873070-50873092 TTGTTCAGGTCCTGAAACATTGG - Intergenic
1192898995 X:75474297-75474319 CCTTTCATGCCCTCAAACATCGG + Intronic
1193716529 X:84940720-84940742 CTCTTAAGGCTCTCAGCCATAGG - Intergenic
1193834230 X:86322517-86322539 CAGGTATGACCCTCAAACATGGG + Intronic
1194256557 X:91642858-91642880 CTCTTAAGGCCCTCAGCCATAGG + Intergenic
1194400480 X:93433886-93433908 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1196422865 X:115540704-115540726 CTGCTAGGGCCCTTAGACATGGG + Intergenic
1196787445 X:119433302-119433324 CTTTTAAGGCCCTCACTGATTGG + Intronic
1196869552 X:120099771-120099793 CTGCCAAGGCCCTCAAACATGGG - Intergenic
1197013551 X:121596248-121596270 CTGTAATTGCCCTCAAACACAGG + Intergenic
1200575278 Y:4882135-4882157 CTCTTAAGGCCCTCAGCCATAGG + Intergenic
1200699175 Y:6387440-6387462 CTGCCAAGGCCTTCAAACATGGG - Intergenic
1200912086 Y:8539619-8539641 CTCCTAAGTCCCTCAAACACAGG - Intergenic
1200948214 Y:8866844-8866866 CTACCAAGGCCCTCAAACACAGG - Intergenic
1201034936 Y:9777258-9777280 CTGCCAAGGCCTTCAAACATGGG + Intergenic
1202037234 Y:20647402-20647424 CTGCCAAGGCCCTCAAATATGGG - Intergenic