ID: 1041030860

View in Genome Browser
Species Human (GRCh38)
Location 8:53733997-53734019
Sequence CTGTTAAGGCCCTCAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041030860_1041030866 21 Left 1041030860 8:53733997-53734019 CCCATGTTTGAGGGCCTTAACAG No data
Right 1041030866 8:53734041-53734063 AAGCAGATAAACTGACTCTTGGG No data
1041030860_1041030865 20 Left 1041030860 8:53733997-53734019 CCCATGTTTGAGGGCCTTAACAG No data
Right 1041030865 8:53734040-53734062 AAAGCAGATAAACTGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041030860 Original CRISPR CTGTTAAGGCCCTCAAACAT GGG (reversed) Intronic