ID: 1041030957

View in Genome Browser
Species Human (GRCh38)
Location 8:53734762-53734784
Sequence GACTGACGCCCGGTAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 33}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041030957 Original CRISPR GACTGACGCCCGGTAGCGGG TGG (reversed) Intronic
902236921 1:15063559-15063581 GACTGTCGCCCTGTAGCCAGAGG - Exonic
906525777 1:46492414-46492436 CACTGACGCCCAGGAGAGGGTGG - Intergenic
911973342 1:104463545-104463567 GACTGATGCTCGGTATTGGGTGG + Intergenic
916060951 1:161098416-161098438 GGCTGGCGTCCGGTAGGGGGAGG + Exonic
1076829906 10:132988983-132989005 GCCTGAGGCCCGGTGGGGGGGGG + Intergenic
1081981592 11:47270184-47270206 GACTGACGCCCCGCTGCCGGGGG + Intronic
1082283623 11:50298101-50298123 GAGTGGCGCCAGGTAGCGGGGGG + Intergenic
1093289323 12:17301797-17301819 GACTGATGCCCGGTAGGGGGTGG - Intergenic
1104854664 12:131896077-131896099 GACTGACGCCCGGCGGGGAGGGG - Intronic
1112733569 13:102394233-102394255 AGCTGGCGCCCGCTAGCGGGAGG + Intronic
1114556865 14:23567236-23567258 GACTCAGGCCCAGGAGCGGGAGG - Exonic
1133924794 16:10183445-10183467 ACCAGACGCCCGGGAGCGGGCGG - Intergenic
1136317240 16:29461552-29461574 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1136431815 16:30200895-30200917 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1143078817 17:4366515-4366537 GACTCACGCCCGGAAGGGGAGGG + Intronic
1144572254 17:16407467-16407489 GCCTGAAGCTCGGTAGCGAGAGG + Intergenic
1145960899 17:28886042-28886064 GCCTGACGCCTGGGGGCGGGGGG + Intronic
1149076146 17:52597699-52597721 GACTGATGCCTGGTAGTGGGTGG - Intergenic
1152654892 17:81514856-81514878 GACTCAGGCCCGGCGGCGGGCGG - Intronic
1153382211 18:4453803-4453825 GACTGACTCCCGGTCGTGGGAGG - Intronic
1163007484 19:14406002-14406024 GACTGAGCCCCGGGAGTGGGCGG - Intronic
1163916810 19:20247280-20247302 GATTGATGCCCGGTAAGGGGTGG - Intergenic
1164481080 19:28611449-28611471 GACTGATGCCCGGGAGGGGGTGG - Intergenic
1167942619 19:52959874-52959896 GACTGATGCCCAGTAGGGTGTGG - Intronic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
931698363 2:64889038-64889060 GACTGATGCCCGGTAGGGGGTGG + Intergenic
932773579 2:74514599-74514621 CGCTGACGCCCGGCAGCGGCTGG + Exonic
947794408 2:232885097-232885119 GTCTGACGCCTGGTGGCAGGCGG + Intronic
947992307 2:234497161-234497183 GCCTGACCCCCGGCGGCGGGCGG - Intergenic
1172062725 20:32197389-32197411 CACTCACGCCGGGTAGCAGGCGG - Exonic
1175783057 20:61695928-61695950 GCCTGAGGCCTGGCAGCGGGTGG - Intronic
1184088165 22:42278320-42278342 AACTGAGGCCCGGGAGAGGGCGG + Intronic
949158138 3:851336-851358 GACTGATGCCCGGTAGGGGGTGG - Intergenic
957022522 3:75141138-75141160 GACTGATGCCCGGTAGGGTGTGG - Intergenic
968232918 3:197015026-197015048 CACTGACGCCCTGTAGCCTGGGG - Intronic
995471637 5:112508252-112508274 GTTTGAAGCCAGGTAGCGGGAGG - Intergenic
1012611666 6:101226952-101226974 GACTGATGCCCGGTAGGGGGTGG + Intergenic
1029432288 7:100539230-100539252 GACAGAAGCTCGGGAGCGGGCGG - Exonic
1032170796 7:129583024-129583046 GACTGATGCCCGGCAGGGGGTGG - Intergenic
1039278408 8:35956467-35956489 GACTGACACCTGGTAGGGGGTGG - Intergenic
1041030957 8:53734762-53734784 GACTGACGCCCGGTAGCGGGTGG - Intronic
1056732497 9:89178184-89178206 GTCGGCCGCCCGGGAGCGGGCGG - Exonic
1060243514 9:121925378-121925400 GATGGAGGCCCGGCAGCGGGAGG - Intronic
1190314748 X:49143308-49143330 GACTGATGCCTGGTAGGGGGTGG + Intergenic
1200699228 Y:6387917-6387939 GACTGATGCCCCATAGTGGGTGG - Intergenic
1201034883 Y:9776781-9776803 GACTGATGCCCCATAGTGGGTGG + Intergenic
1202037329 Y:20648171-20648193 GACTGATGCCCAGTAGGGGGTGG - Intergenic