ID: 1041031329

View in Genome Browser
Species Human (GRCh38)
Location 8:53738388-53738410
Sequence ATTGCTTTCTCTTCCTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041031329_1041031331 30 Left 1041031329 8:53738388-53738410 CCACAGAAGGAAGAGAAAGCAAT 0: 1
1: 1
2: 4
3: 53
4: 520
Right 1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041031329 Original CRISPR ATTGCTTTCTCTTCCTTCTG TGG (reversed) Intronic
900006561 1:58772-58794 TTTGATTTCTCTGCCTTCTTAGG - Intergenic
900949911 1:5852813-5852835 GTGGCTGGCTCTTCCTTCTGTGG - Intergenic
901117317 1:6857651-6857673 AATGCCTTCTCTTCCCTCTATGG - Intronic
901392289 1:8954488-8954510 CTTGCTTTCACTTTATTCTGTGG + Intronic
903006293 1:20301082-20301104 ATTGCCTTCCCTTCTCTCTGAGG - Intronic
903088461 1:20885836-20885858 ATTGCTTTATGTTCCTTGTCAGG - Intronic
904053562 1:27655777-27655799 TCTGCTTCCTCTTCTTTCTGTGG - Intergenic
904409123 1:30314407-30314429 AATTCTTGCTCTTCCTGCTGGGG - Intergenic
905249943 1:36641832-36641854 ATTGCTTGGTCTTTCTTGTGTGG + Intergenic
905771063 1:40638293-40638315 AGAGCTTTCTCCTCCCTCTGAGG - Intronic
906383561 1:45348009-45348031 ATTATTTTCTCTTCCTTCCTGGG - Intronic
906731452 1:48084974-48084996 ATTGCTCTGACTGCCTTCTGAGG - Intergenic
907145147 1:52224449-52224471 TTTGCTTTCTCATCCTTTAGGGG + Intronic
907628233 1:56052953-56052975 TTTCCTTTGTCTTCCTGCTGTGG - Intergenic
908164555 1:61445588-61445610 ATACTTTTCTCCTCCTTCTGAGG - Intronic
908345718 1:63230218-63230240 ATTTCTTCCTTTTCCTTTTGAGG + Intergenic
908513404 1:64868517-64868539 GCTGCTTTCTCTTTTTTCTGTGG - Intronic
908896627 1:68908388-68908410 ATTCATTTCTTTTCTTTCTGGGG + Intergenic
909708824 1:78620262-78620284 CTTTCTTTCTCTTCCTAGTGAGG + Intronic
909708830 1:78620353-78620375 CTTTCTTTCTCTTCCTAGTGAGG + Intronic
909899267 1:81111994-81112016 AGTGATTTTTCTTCCTTCTTTGG + Intergenic
910229563 1:84972212-84972234 ATTGATTTCTGTTCCTTAAGTGG - Intronic
910245790 1:85136717-85136739 AGTGATGTCTCTTCCTTCTCTGG + Intergenic
910962479 1:92777624-92777646 ATTGTTGTCTCCTCCTTATGGGG - Intronic
910997463 1:93122683-93122705 ATTTCTTACTGTTCTTTCTGTGG + Intronic
911372133 1:97006336-97006358 TTTGGTTTCTCTTCCCACTGGGG + Intergenic
912221739 1:107685880-107685902 TTTCCGTTCTCTTCCTGCTGGGG - Intronic
912460422 1:109827269-109827291 ATTGCTTACTCTCGCTTCTTCGG - Intergenic
913016581 1:114742636-114742658 CTTGCCTTATCTTCCATCTGAGG - Intronic
913134387 1:115873881-115873903 CTTGCTTTCACTTCACTCTGTGG - Intergenic
915157318 1:153888648-153888670 ACTACTTTCTCTTTCGTCTGTGG - Intronic
915493151 1:156262885-156262907 GTAGCTTTCCCTTCCTTCTCAGG - Intronic
915709361 1:157879947-157879969 ATTACTTTCTATTCCTTGTTGGG - Intronic
916465029 1:165065376-165065398 ATTGTTTTCACTTTCCTCTGTGG + Intergenic
917466114 1:175277725-175277747 CTTGCTTTCACTTTATTCTGTGG + Intergenic
917493705 1:175520863-175520885 TCTGCTTTTTCCTCCTTCTGTGG + Intronic
917544715 1:175951849-175951871 ATTTTTTTCTCTTCCTTCTTTGG - Intronic
918645526 1:186899725-186899747 ATTGCTTGCTAATGCTTCTGAGG - Intronic
919560287 1:199109785-199109807 ATTTCTCTTTCTACCTTCTGGGG + Intergenic
920009094 1:202854846-202854868 GATGCGTTCTCTTCCTTTTGCGG - Intergenic
920596450 1:207276755-207276777 ATTGTTTTCTGTTTTTTCTGTGG + Intergenic
923106461 1:230857493-230857515 ATGGCTGGCTCTTCCTCCTGGGG - Intronic
923279526 1:232429742-232429764 ATTGTTTTGTTTTCCTTATGTGG - Intronic
923476288 1:234334430-234334452 ATTGCTTTGTTTTCCTTGTAGGG - Intergenic
923668074 1:236016096-236016118 ATTTCTTTCTCTGCTTTTTGAGG - Intronic
1063419721 10:5902125-5902147 ATTGGCTTCTCTTCCATTTGGGG + Intronic
1065294023 10:24257923-24257945 ACTCCTTTCTCTTCCTTCAGTGG + Intronic
1065800621 10:29348591-29348613 ATCACTTTCTCTTCCCACTGTGG - Intergenic
1066139645 10:32490364-32490386 ATGGCTTTTTCTTCTTTCTGGGG + Intronic
1066744278 10:38590349-38590371 ATTGCTTTCCATTCCATTTGAGG - Intergenic
1067542337 10:47165263-47165285 ATTGCTCTTTCTTGCCTCTGAGG - Intergenic
1070001238 10:72379137-72379159 CCTGATTTCTGTTCCTTCTGTGG - Intronic
1072674130 10:97452931-97452953 TTTGCTTTCTCTTCTGCCTGAGG + Intronic
1072971637 10:100022415-100022437 ATTGCTCTCTCTTACAACTGAGG + Intergenic
1073253985 10:102139349-102139371 GTTGCTTTATCTTCCTCCTCAGG - Exonic
1073295160 10:102434459-102434481 ATTGCTTTCTCTTCCACCTCTGG + Intergenic
1073664986 10:105521488-105521510 ATTGCCTTTTTTTCTTTCTGGGG - Intergenic
1073859751 10:107724482-107724504 CTAGCTTTTTCTTCTTTCTGTGG + Intergenic
1074122043 10:110499784-110499806 ATTTCTTTCTCTTCCTAATATGG + Intronic
1074299259 10:112218574-112218596 CTTGCTTTCACTTCACTCTGTGG - Intergenic
1074558850 10:114517091-114517113 AGTGCTTGCTCTTCCCTCTCAGG - Intronic
1074657797 10:115615159-115615181 ATTCCTTTCTCTTTCTCATGAGG + Intronic
1074835251 10:117285753-117285775 ATTGCTTTCTATCTCTTCTTAGG + Intronic
1078026183 11:7697720-7697742 ATTCCTTCCTTTTCATTCTGTGG + Intronic
1078302031 11:10141221-10141243 ATAGCTTTCTCTTCTTTCCTGGG - Intronic
1078746930 11:14124843-14124865 ATTATTTTCTATTTCTTCTGAGG - Intronic
1079002463 11:16769641-16769663 ACTGCTTTCTTTTCCTTCCAGGG - Intergenic
1079247692 11:18765201-18765223 CCTTCTTTTTCTTCCTTCTGAGG + Intronic
1079403554 11:20125937-20125959 CCAGCTTTCTCATCCTTCTGTGG + Intergenic
1079557743 11:21782039-21782061 ATGGCTTTATTTTACTTCTGAGG - Intergenic
1079702466 11:23565829-23565851 ATTGCTTTATTTTCTTCCTGTGG + Intergenic
1080326043 11:31074617-31074639 ATTTATTTCTCATACTTCTGAGG - Intronic
1080388083 11:31821749-31821771 ATTTCTTTCTCTCCCTTGTCCGG + Intronic
1080567734 11:33527194-33527216 TTTGATTTCTCTTCTTTCTTGGG - Intergenic
1080978196 11:37367026-37367048 TTTGCTTTCTCTTCCCCCTCAGG - Intergenic
1081175912 11:39926309-39926331 ACTACTTTCTATTCCTTCTAGGG - Intergenic
1081336969 11:41878949-41878971 TTTTAATTCTCTTCCTTCTGTGG + Intergenic
1081431250 11:42978970-42978992 TTTGCTCTCTCTTCCTCATGGGG - Intergenic
1081880295 11:46444450-46444472 ATTTCCTCCTCCTCCTTCTGAGG + Intronic
1082921484 11:58499462-58499484 ATAGATTTCTCTTCCTTAGGGGG + Intergenic
1082940719 11:58702901-58702923 GTAACTTTATCTTCCTTCTGAGG - Intronic
1082972362 11:59037079-59037101 ATAGCTTCCTCTCCCATCTGTGG - Intronic
1082976834 11:59080963-59080985 ATAGCTTTCTCTCCCATCTGAGG - Intergenic
1083075328 11:60031504-60031526 ATGACTTGCTCTTCCTTTTGAGG + Intergenic
1083698581 11:64458765-64458787 ATTGCTTTGTCCTCAGTCTGTGG - Intergenic
1084090854 11:66878686-66878708 CCTGCTTTCGCTTCCCTCTGAGG - Intronic
1084127216 11:67107540-67107562 ACTGCTTTCTCTTTGTTCTCTGG - Intergenic
1084206947 11:67600636-67600658 ATTACATTTTCTTCCTCCTGGGG - Intergenic
1084529580 11:69719025-69719047 TTTGCTAACTCTCCCTTCTGAGG - Intergenic
1084582646 11:70033549-70033571 ATAGCTTTCTCTTCTCCCTGTGG + Intergenic
1084935658 11:72585268-72585290 TTCCCTTTCTCTGCCTTCTGCGG - Intronic
1085374924 11:76051823-76051845 ATTGTTTTTTCCTCCTTCTTTGG - Intronic
1085521004 11:77138758-77138780 CTAGCTTTCTCTTCCATCAGCGG - Intronic
1085928550 11:81053334-81053356 ATTGTTTTCTCATTCTTTTGAGG - Intergenic
1088798970 11:113288334-113288356 TTTGCTTCCTCTGCCTTCAGTGG - Intergenic
1089318191 11:117606269-117606291 AATGCATTCTCTTCCTTCCATGG + Intronic
1090769899 11:129910656-129910678 ATTGCTTTCTCTTTCTCCCCAGG - Exonic
1094280132 12:28727777-28727799 ATAGCTTGTGCTTCCTTCTGTGG - Intergenic
1094439164 12:30455975-30455997 ATTTCTTTTTCTTCCTTCTGTGG - Intergenic
1094742401 12:33304790-33304812 AATGCTTTTTCTTCATTCTCTGG + Intergenic
1094758139 12:33495717-33495739 ATTGTTTGCTCTTGCTTCTTTGG - Intergenic
1095742087 12:45618783-45618805 ATACCTTTCACTTCCTTCTGGGG - Intergenic
1096226022 12:49867432-49867454 ATTCCCTACTCTTCCTTCCGAGG - Exonic
1096459156 12:51812614-51812636 TTTCCTTTCACTTGCTTCTGGGG + Exonic
1098482833 12:70985575-70985597 ATAGCCTACTATTCCTTCTGTGG + Intergenic
1099281330 12:80651511-80651533 ATTGCTTTCTCTCTTTTCAGTGG - Intronic
1099647961 12:85383733-85383755 TTCCCTTTCTCTTTCTTCTGTGG + Intergenic
1099923556 12:88988734-88988756 ATTGCTTTTTCTTTCTGCTGAGG + Intergenic
1100161059 12:91861458-91861480 ATTCATTTCTCTACCTTCTAAGG + Intergenic
1100689627 12:97025915-97025937 ATTGCATTCTCCTCATTATGGGG + Intergenic
1100796549 12:98187738-98187760 AGTCCTTTCTCTCCCCTCTGAGG - Intergenic
1102002429 12:109565835-109565857 TTTGCTTTCTCTGCCTTATGAGG - Intronic
1102989758 12:117306581-117306603 ATTGCTTTTTTTTCTTGCTGAGG - Intronic
1103425718 12:120831600-120831622 ACAGCTTTCCCTTCCTACTGTGG + Intronic
1103646842 12:122400583-122400605 CTTGCCCTCTCTTCCTTCTCTGG + Intronic
1105838561 13:24232435-24232457 AATGCTTTATCAGCCTTCTGGGG + Intronic
1106777348 13:33020949-33020971 AATGCCATCTCTTCCTTCTATGG + Intronic
1106835015 13:33625059-33625081 TTTGCTTCCTGTCCCTTCTGAGG + Intergenic
1107290042 13:38841675-38841697 ATCACTGGCTCTTCCTTCTGAGG + Intronic
1107682627 13:42867157-42867179 AGTGCTTTCACTTTCTGCTGTGG + Intergenic
1107893872 13:44938870-44938892 ATTGCTTTCTCTTGCATCCCAGG - Intergenic
1108319028 13:49269131-49269153 ATGACTTTCTCTTCTTTCTTGGG - Intronic
1108429385 13:50338918-50338940 AATGTTTTCCCTTCCTTCTCAGG + Intronic
1109229578 13:59740609-59740631 TTTGCTTTTACTTCCTTCTGTGG - Intronic
1109375259 13:61484903-61484925 ATTGATTTTTCTTCCTCCTCTGG + Intergenic
1109791840 13:67259247-67259269 CTTGCTTTCCCTTTCCTCTGTGG - Intergenic
1109965835 13:69694117-69694139 ATTGTTTTGTTTTACTTCTGGGG + Intergenic
1111093774 13:83482417-83482439 TTTTCTTTCTCTTCTTTCTGTGG - Intergenic
1111266679 13:85824169-85824191 CTTGCTTTTACTTTCTTCTGTGG + Intergenic
1111438764 13:88249133-88249155 ACTTCTTTCTTTTCCTTTTGGGG + Intergenic
1111858391 13:93669712-93669734 CTTGCTTGCTCTTCCTTCCTTGG - Intronic
1112468474 13:99666638-99666660 ATTGCTTTCTATTCCTGCTGGGG + Intronic
1112671443 13:101643902-101643924 AGCTCTTTCTCTTCTTTCTGGGG + Intronic
1115450263 14:33539638-33539660 ATTACTTTCACTTCTTTTTGTGG - Intronic
1115756642 14:36533592-36533614 ATAGATTTCTCTTTTTTCTGGGG + Intergenic
1118489517 14:66245404-66245426 TTTTCTTTTTCTTTCTTCTGAGG - Intergenic
1118630049 14:67694731-67694753 TTTATTTTCTCTTCCTTCTCTGG - Intronic
1119186189 14:72644138-72644160 ATTGCTGTTTCTTCTTTTTGAGG - Intronic
1119998232 14:79276666-79276688 ACTGCTTTGACTTCATTCTGAGG - Intronic
1120011025 14:79414387-79414409 TTTGTTTTCTCTTCCTTTTAGGG + Intronic
1120118899 14:80654114-80654136 ATGCCTATCTCTTCCTCCTGAGG - Intronic
1120130478 14:80800912-80800934 TTTCATTTCTCTTCTTTCTGAGG - Intronic
1120510144 14:85403335-85403357 ATTTTTTTCTTTTCCTGCTGTGG - Intergenic
1121359985 14:93248011-93248033 ACTGCTCTCTCTTCCTTGTTTGG - Intronic
1122403350 14:101480787-101480809 TTTGCTTTCTCTTCCTCCCCGGG + Intergenic
1122811639 14:104292225-104292247 CTTTCCTTCTCTTCCTTCTTGGG - Intergenic
1123928174 15:25139446-25139468 ATTGCTTTCTGGTCCTTATCTGG + Intergenic
1124195952 15:27629690-27629712 ATTGCTTTCCCTTCCCTAGGTGG + Intergenic
1124969427 15:34471297-34471319 ATGCCTATCTCTTCCTTCTTTGG - Intergenic
1125238706 15:37548611-37548633 ATTCCTTACTCTTCCTCCTAGGG - Intergenic
1125990423 15:44101286-44101308 CTTGCTTTATATTCTTTCTGGGG - Intronic
1126502999 15:49368061-49368083 GTTGCTTACTCTTGCTTTTGAGG - Intronic
1126614458 15:50562694-50562716 ATTGCAATCTCTGCCTACTGGGG - Intronic
1126695470 15:51321885-51321907 ATGGGTTTCTCTTCCTTTTGGGG - Intronic
1126699467 15:51355123-51355145 CTTGCTTTCACTTTATTCTGTGG - Intronic
1126999003 15:54480772-54480794 CTTGCTTTCTCTTATTTCTTGGG + Intronic
1127298004 15:57626990-57627012 TTTGTTTTCCCTTCCTCCTGTGG + Intronic
1127732406 15:61812894-61812916 CTTGCTTTCTCTGCCATGTGAGG + Intergenic
1128358217 15:66943224-66943246 CATGCTTTCTCTTCCTGCGGGGG - Intergenic
1128962235 15:72018908-72018930 ATTGATTTATCTTCCTTCCTAGG + Intronic
1129699444 15:77759213-77759235 ATTGCTTCCCCTTCCTTCACTGG + Intronic
1130164438 15:81438394-81438416 ATAGCTTTCTTTGCCTTTTGGGG - Intergenic
1131126663 15:89864394-89864416 CTTCCTTTCTCTTCCTACTAAGG - Intronic
1131849068 15:96518477-96518499 ATTACTTTCTCTTATTTTTGTGG + Intergenic
1132189866 15:99844146-99844168 ATGCCTATCTCTTCCTTCTTTGG + Intergenic
1132304757 15:100802962-100802984 ATTGCTTGCTCTGCCTTATTTGG - Intergenic
1132446959 15:101932185-101932207 TTTGATTTCTCTGCCTTCTTAGG + Intergenic
1132560910 16:593399-593421 ATTGCTTTCTCTCCTTTGTTGGG + Intronic
1133245721 16:4447559-4447581 AAGGCTTTCTCCTCCATCTGGGG + Intronic
1134346897 16:13399591-13399613 ATTGCTTTCTGTTCTTTCCATGG + Intergenic
1135811293 16:25588988-25589010 CTTGCTTTCACTTCATTCAGTGG + Intergenic
1136081155 16:27853455-27853477 ATTTCTTGCTCTGCCCTCTGAGG + Intronic
1140016987 16:71197013-71197035 CTTGCTTTCACTTTATTCTGTGG + Intronic
1142703251 17:1677393-1677415 ATTTCTTGGGCTTCCTTCTGGGG - Intronic
1143215668 17:5223022-5223044 AGTGCTTTTTCTTCCCTATGTGG - Intronic
1143604825 17:7976803-7976825 ATAGATTGCTCTTCTTTCTGAGG + Intergenic
1143923129 17:10346796-10346818 ATTTTTTTCTCTTCCTTCAGTGG - Exonic
1144359932 17:14482270-14482292 GTTGGGTTCTCTTCTTTCTGGGG + Intergenic
1144531356 17:16042174-16042196 ATTGTTTTCTAGTTCTTCTGAGG - Intronic
1145331654 17:21877438-21877460 ATTGGTTTCCTTTCCTTTTGAGG - Intergenic
1146470506 17:33120743-33120765 GTTGCTTGCTCTTTCTTCTGAGG + Intronic
1146488908 17:33265814-33265836 ATTGTTTTGTCTTCCTCATGTGG + Intronic
1146754572 17:35416940-35416962 AATGGTTTGTCTTCCTTTTGTGG - Intronic
1147032074 17:37646656-37646678 GTGGCTTCCTCTTCCTTCTTCGG - Intergenic
1147872545 17:43597802-43597824 ATTGCTTTCTGAGCCTCCTGGGG - Intergenic
1148621448 17:49037833-49037855 ATGGCTTGCTCTTCCTTTTTAGG + Intronic
1148837377 17:50472530-50472552 ACTGCTTCCTCTGTCTTCTGAGG - Exonic
1149182167 17:53952180-53952202 ATTTTTCTCTCTGCCTTCTGGGG - Intergenic
1149309132 17:55377189-55377211 TCTGCTTTCTCTTCATTCTTTGG + Intergenic
1149646123 17:58242894-58242916 TTGGCTTTCTCTGCTTTCTGTGG + Intronic
1150348677 17:64424464-64424486 CTTGCTTTCTCTTTACTCTGTGG - Intergenic
1150447214 17:65235883-65235905 CTTGCTTTCACTTTCCTCTGTGG + Intergenic
1151794151 17:76331808-76331830 ATTGCTTTATTCTCCTTGTGTGG - Intronic
1152004662 17:77672576-77672598 CTGGCTTTGTCTTCCCTCTGTGG - Intergenic
1153206993 18:2714116-2714138 ATTGCTTTCTATGTCTTCTTAGG + Intronic
1153661221 18:7327951-7327973 CTTGCTTTCTCTCCCTCCTCAGG - Intergenic
1155371477 18:25106250-25106272 GTTGTTTTCTCTTCCTCATGTGG + Intronic
1155858469 18:30865671-30865693 ATTTCTTTCTATCCCTTCTAAGG - Intergenic
1156606991 18:38678687-38678709 TTAGCTTTCTCTTCTTTCTTGGG + Intergenic
1157068379 18:44377919-44377941 TTTGTTTTCTCTTGCTTCTCTGG - Intergenic
1157330237 18:46698736-46698758 CTTCTTTTCTCTGCCTTCTGAGG - Intronic
1157351197 18:46887446-46887468 ATTGCTTTCTTTTCTTTCTTGGG - Intronic
1157403288 18:47403784-47403806 ATGGTTTTCCCTCCCTTCTGGGG - Intergenic
1158503846 18:58028485-58028507 ATTGCTTTCACTGTCTTCAGCGG + Intergenic
1160165444 18:76507281-76507303 ATTGCTTTCTCCTCTCACTGAGG + Intergenic
1160280268 18:77483601-77483623 ATTTCTTGCTCTTCCTTCACTGG - Intergenic
1160638317 19:100348-100370 TTTGATTTCTCTGCCTTCTTAGG - Intergenic
1163544169 19:17931274-17931296 ATTGCAATCTCTGCCTCCTGGGG + Intergenic
1163854271 19:19687346-19687368 ACTGCTTTCCCTCCCTCCTGGGG + Intergenic
1163901225 19:20101747-20101769 TTTTCTTTCTCCTCCTTCTCTGG - Intronic
1163956689 19:20649118-20649140 TTTTCTTTCTCCTCCTTCTCTGG + Intronic
1163959471 19:20675017-20675039 TTTTCTTTCTCCTCCTTCTCTGG - Intronic
1165040918 19:33066778-33066800 ATTGCATTCTGTTCCACCTGTGG - Intergenic
925823402 2:7822810-7822832 ATCAATTGCTCTTCCTTCTGCGG - Intergenic
926105584 2:10147830-10147852 ATTTCTTTATCTTTCTTATGGGG - Intronic
927270638 2:21206328-21206350 ATTGCCTTCCTTTCCTTCTGTGG + Intergenic
927431017 2:23026126-23026148 TTTGCCATCTCTTCCTTCTCTGG + Intergenic
928188881 2:29143171-29143193 CTTGCTTTCTCATGCCTCTGCGG + Intronic
928210755 2:29321944-29321966 ATCCTTTCCTCTTCCTTCTGTGG - Intronic
928729659 2:34216454-34216476 ATTTCTGGCTCTGCCTTCTGGGG + Intergenic
928831252 2:35486838-35486860 ATTGCTTTCTTTATCTTCTTTGG + Intergenic
930046717 2:47178800-47178822 ATTGATGGCTCTTCCATCTGAGG - Intergenic
930285388 2:49421685-49421707 ATTTCTTTCTTTTCCTTCCTAGG + Intergenic
930351129 2:50255924-50255946 ATGACTTTCTCTTCCTTCCTTGG + Intronic
930715601 2:54591419-54591441 ATTGCTGTCTCTTACTTAGGGGG + Intronic
931054614 2:58455184-58455206 TTTTCTTTTTCTTACTTCTGTGG + Intergenic
931638542 2:64361901-64361923 ATCGCTTCCTCTTCCTTCAGTGG - Intergenic
931978214 2:67666474-67666496 ATTGCATCCACTTCCTTGTGGGG - Intergenic
932521554 2:72419893-72419915 CTTTCTCTCTTTTCCTTCTGGGG + Intronic
932619470 2:73257302-73257324 ATTGCTGACTTTTCCTCCTGTGG - Exonic
932631751 2:73350504-73350526 ATTTCTTTCTCTTGCTTTTCAGG + Intergenic
933272558 2:80248773-80248795 ATTTCTCTCTCTACATTCTGAGG - Intronic
933526545 2:83447530-83447552 TTTGCCTTAGCTTCCTTCTGTGG - Intergenic
933845764 2:86325975-86325997 ACTGCTTTGTCTTCCTACCGGGG - Intronic
934728892 2:96643765-96643787 CTTTCTTTCCCTTCCTTCTTGGG - Intergenic
935101625 2:100001275-100001297 TTTGCTTTCTCTTTCCTCTCTGG - Intronic
935140396 2:100348259-100348281 GTTACTTTCTGTTCCTTTTGAGG + Intergenic
935200768 2:100854519-100854541 AATGCTTTCTCTTTCCCCTGGGG - Intronic
935581571 2:104760244-104760266 AGCACTTTCTCTTCCTTCTGCGG - Intergenic
935753526 2:106259867-106259889 ATTTCTTTATCTTCCCTGTGAGG - Intergenic
936157853 2:110060785-110060807 ATTGCTTTGGCTTCCTTTTATGG + Intergenic
936186839 2:110310659-110310681 ATTGCTTTGGCTTCCTTTTATGG - Intergenic
936803352 2:116294289-116294311 ATTATTTTCTCTCCCTCCTGAGG + Intergenic
936841099 2:116770384-116770406 AATGCTTTCTTTTCATTCAGAGG - Intergenic
936960768 2:118072114-118072136 ATTTCTTTGCCTTCCTACTGTGG + Intergenic
937640345 2:124204455-124204477 GTTGCTTTCACATCATTCTGGGG + Intronic
937802272 2:126094287-126094309 ATTTCTTTCTCTTGTTTTTGTGG - Intergenic
937831272 2:126426677-126426699 ATTGGTTTTCCTTCCTTCTGGGG + Intergenic
937857570 2:126683538-126683560 AGTGCTTTTTCTCCCTTGTGAGG - Intronic
938298289 2:130192131-130192153 ACTGCTTTCTTTCCCTTCTCTGG - Intronic
938458478 2:131482526-131482548 ACTGCTTTCTTTCCCTTCTCTGG + Intronic
938746132 2:134280161-134280183 ATTGCTTTCTCTCCTTTTTCTGG - Intronic
938751086 2:134331344-134331366 TTTGTTTTCTCTTCATTTTGTGG + Intronic
938906425 2:135840886-135840908 ATAGCTCTCACTTCCCTCTGTGG + Exonic
938978379 2:136501672-136501694 CTTGCTTTCTCTTCATTCTCAGG - Intergenic
939047849 2:137270429-137270451 GTTGGTCTCTCCTCCTTCTGAGG + Intronic
939253572 2:139715042-139715064 CTTGCTTTCACTTTATTCTGTGG - Intergenic
939432288 2:142126627-142126649 ATAGATTTCTCTATCTTCTGTGG - Intronic
939664708 2:144936790-144936812 AGTGTTTTCTCTTCCTCCTTTGG - Intergenic
939690061 2:145248366-145248388 ATTTGTTTCTCTCCCTTCCGAGG - Intergenic
939735594 2:145840571-145840593 ATTATTTTCTCTTCCTACTAAGG - Intergenic
939898574 2:147822878-147822900 CTTTCTCTCTCTTCCTTCTGCGG - Intergenic
940082046 2:149813994-149814016 ATTGCTTTCTGATCCTTCATTGG + Intergenic
940336130 2:152529366-152529388 ATGCCTTTCTTTTTCTTCTGAGG - Intronic
940394913 2:153177366-153177388 ATGCCCTTTTCTTCCTTCTGTGG - Intergenic
941251253 2:163166445-163166467 ATTCCTTTTTCTTCCTTCTGTGG + Intergenic
941261170 2:163299388-163299410 ATTTCTTTCTCTTTCCTCTCAGG + Intergenic
942168241 2:173263808-173263830 ACTGCTTTCACTTCATCCTGAGG - Exonic
942207242 2:173631379-173631401 ATGGCTTTCCCTTCCTTTTCTGG + Intergenic
942441043 2:176037088-176037110 ATTACTTTCTATTCTTTCAGTGG - Intergenic
942610173 2:177735370-177735392 ATTGTTTTTTCTTTCTTCTTGGG - Intronic
942905625 2:181177102-181177124 CCTGATTTCTCTTGCTTCTGTGG - Intergenic
943795847 2:191992721-191992743 CTTGCTTTCTCTTCTCTATGTGG + Intronic
944356748 2:198798832-198798854 ATTGTTTTATATTCCTTTTGAGG - Intergenic
944370375 2:198975048-198975070 ATTTCTTTCTTTTCCTTTTGAGG - Intergenic
944546507 2:200804167-200804189 TTTTCTTTCTCTTCCCTCTATGG - Intergenic
944682752 2:202091855-202091877 ATTGCTTTCTCTTCTTCCTCAGG - Intronic
945585398 2:211655204-211655226 AATGCTCTCTCTTCCTTCAAGGG + Intronic
945722180 2:213431155-213431177 ATTTCTTTCTCTTCTTCCTTTGG - Intronic
945813137 2:214572239-214572261 ACTGTTCTCTCCTCCTTCTGGGG - Intronic
945902039 2:215549562-215549584 CTTGCTTTTGCTTCATTCTGTGG - Intergenic
946377924 2:219325079-219325101 ATTGGCTTTTCTTCCTTCTTTGG - Intergenic
946462053 2:219877537-219877559 CTTGCTTTCACTTTATTCTGTGG + Intergenic
946893908 2:224303542-224303564 CTTGCTTTCACTTCACTCTGTGG - Intergenic
948323592 2:237092715-237092737 ACTGTCTGCTCTTCCTTCTGTGG - Intronic
1169453535 20:5732520-5732542 ACTGCTTTCTCTTCCCTCTCTGG + Intergenic
1170512971 20:17097989-17098011 ATTGCTTTCTGTTACTCCTGTGG - Intergenic
1170645986 20:18196335-18196357 ATTGCAATCCCTTCCATCTGTGG - Intergenic
1170829559 20:19828359-19828381 ACAGCTTTCTGATCCTTCTGAGG + Intergenic
1171925224 20:31183661-31183683 CTTGCTTTCTATTCCTTTCGAGG - Intergenic
1173368795 20:42415985-42416007 AATGCTTTCTCTTCCTGTAGTGG + Intronic
1173511337 20:43631318-43631340 AGTTATTTCTCTTCCCTCTGTGG + Intronic
1173690213 20:44954979-44955001 ATTGCCTTGTCTGTCTTCTGAGG - Intronic
1173748605 20:45457951-45457973 ATTGCTTTCTCTGCCAACTTTGG + Intergenic
1174106011 20:48162749-48162771 ATCGCTTGCTCATCCTTCTGCGG - Intergenic
1174685947 20:52455197-52455219 AGAGATTGCTCTTCCTTCTGGGG + Intergenic
1175217982 20:57401427-57401449 ACTGCTTTCTCTGCCTTCTTGGG + Intronic
1175339328 20:58218181-58218203 ATTACCTTCTCTCCCTTCTGGGG - Intergenic
1175646620 20:60679621-60679643 ATTCCTTTCCCTGCCCTCTGTGG - Intergenic
1177495697 21:21888168-21888190 ACTGTTTTCCCTTCATTCTGAGG - Intergenic
1178329847 21:31678636-31678658 TTTGCTCTCCCTTCCTGCTGTGG + Intronic
1178418404 21:32423145-32423167 CTTGCTCTGTCTTCCTGCTGAGG + Intronic
1178558662 21:33617386-33617408 ATTGTTTTCTACTCCTCCTGTGG + Intronic
1179354390 21:40645163-40645185 TTTCCTTTCCCTTCCTTCTGTGG + Intronic
1180966813 22:19793478-19793500 TTCACTTTCTCCTCCTTCTGGGG - Intronic
1181448510 22:22999851-22999873 TTTACTCTCTCTTCCTTCTCTGG - Intergenic
1182579123 22:31293481-31293503 ATTGCTTTTTCTTACATTTGAGG + Intergenic
1182644704 22:31798785-31798807 CTTGCTTTCACTTTATTCTGTGG - Intronic
1182880550 22:33729315-33729337 GTCTTTTTCTCTTCCTTCTGAGG - Intronic
1183238645 22:36639491-36639513 ATTTCTCTCTCTCCCTTCAGGGG + Intronic
1184396847 22:44247344-44247366 AAGGCTTCCTCTGCCTTCTGAGG + Exonic
1184815506 22:46865779-46865801 TTTGCTTACTCTTTGTTCTGGGG + Intronic
1185173808 22:49307816-49307838 TTTGTTTTCTCTTCCCACTGTGG - Intergenic
1185182692 22:49372400-49372422 AGCGGTTTCTCTTTCTTCTGAGG - Intergenic
1185252319 22:49810543-49810565 AATACTTTCTCTTCATTCTGTGG - Intronic
1185407332 22:50660709-50660731 ATTTTTTTCTCTTCCTTTTCTGG + Intergenic
949132836 3:526059-526081 AATATTTTCTATTCCTTCTGAGG - Intergenic
949879769 3:8652116-8652138 ATTGTTTGATTTTCCTTCTGGGG - Intronic
950252542 3:11478674-11478696 ATTGTTTTCCTTTCCTTTTGGGG - Intronic
951041264 3:17991086-17991108 ATTGCTTTCTCTTAAGTCTTAGG - Intronic
951288571 3:20846521-20846543 ATTGATTTCTCTTTTTTCTGAGG + Intergenic
951304870 3:21046971-21046993 ATTGCTTTCTTTGCCTTTTATGG + Intergenic
951684050 3:25324973-25324995 CTTGCTTTCACTTTATTCTGTGG - Intronic
951930683 3:27963633-27963655 GCTGCTTTCTTTTCCCTCTGAGG + Intergenic
952253937 3:31679606-31679628 ACTGCCTTCTCTACCTTCTCTGG + Intronic
952812362 3:37415797-37415819 ATTGATTTTACTTTCTTCTGTGG - Intronic
953011022 3:39025337-39025359 CTTGCTTTCACTTCCCTCTATGG - Intergenic
953033193 3:39191091-39191113 TTTCCTCTCTCCTCCTTCTGAGG - Intronic
953195637 3:40730626-40730648 TTAGATTTCTCTTCCTCCTGAGG + Intergenic
953443788 3:42944672-42944694 AAAGCTTTCTCTTCCCTCTTGGG + Intronic
954201470 3:49025822-49025844 ATAGCTCCCTCTTCCTTCTGGGG - Intronic
954670137 3:52286525-52286547 ATTTCTTTCTCTTGGTTTTGAGG - Intronic
954924410 3:54219548-54219570 TTGGGTTTCTCTTCCTTCGGGGG + Intronic
954941072 3:54373849-54373871 CTTGCATTTTCTTCCTGCTGTGG + Intronic
955298966 3:57759009-57759031 ATTTTTTTCTCTTCCTTTTGAGG - Intronic
956008879 3:64809114-64809136 ATTTTTCTCTCTTCTTTCTGAGG + Intergenic
956942192 3:74176063-74176085 ATTACATTCTCTTTCTTCTACGG + Intergenic
957237417 3:77612330-77612352 GTTACTTTCTCATCCTTCTTCGG + Intronic
957671369 3:83306581-83306603 GTTGCTTTTTTTTCTTTCTGAGG + Intergenic
958042227 3:88240544-88240566 ACTGTTTTCTCTTTCTTATGGGG + Intergenic
960600579 3:119454049-119454071 ATTGCTTTTTCTTCTGTCTGGGG - Intronic
960683240 3:120271006-120271028 ATGAGTTTCTCTTCTTTCTGAGG + Intronic
961030138 3:123595617-123595639 ATTGCTTCCTCTTCCACCTCTGG + Intergenic
963595530 3:147319803-147319825 ATTTCTTCCTCTTCTTTTTGAGG - Intergenic
963691679 3:148511916-148511938 AGTACTTTCTCTTTCATCTGGGG + Intergenic
963717534 3:148821151-148821173 TTTACTATCTCTTCCCTCTGAGG - Intronic
963825570 3:149949631-149949653 CTTTCTTTCTTCTCCTTCTGAGG + Intronic
964564370 3:158033651-158033673 TTTGCTTTCTCTTCTCTCTCAGG - Intergenic
964987471 3:162762496-162762518 TTTGCTTTCACTTTCCTCTGTGG - Intergenic
965071788 3:163924233-163924255 TTGGCTTCCTCTTCCTCCTGGGG + Intergenic
965267218 3:166559690-166559712 ATTTCTTTCTCTTCTCTCTTAGG + Intergenic
965291145 3:166882596-166882618 TTTGCTTTCTCTTCTCTCTCAGG - Intergenic
965312685 3:167150342-167150364 ATTGATTTTCCTTTCTTCTGAGG + Intergenic
965670527 3:171143195-171143217 ATCGCTTTCCCAACCTTCTGAGG + Intronic
966244206 3:177788268-177788290 TTTGCTTTCTTTTCCTATTGTGG + Intergenic
966317963 3:178669902-178669924 CTTGCTTTCTCTTATCTCTGTGG - Intronic
966423482 3:179756872-179756894 ATTACTTTCTCTTATTACTGAGG + Intronic
967562498 3:190933413-190933435 ATTGGTTTCTATTCCATCTGAGG - Intergenic
967587865 3:191236406-191236428 ATTGCTTTCACTTTACTCTGTGG - Intronic
968041237 3:195591084-195591106 ACTCCTTTCTCTCCCTGCTGGGG - Intergenic
969202889 4:5619765-5619787 ATTGCTTTCTCATCCTCAAGGGG + Intronic
969691705 4:8707455-8707477 ATTGCTTTCTTGTCCTTCCTGGG - Intergenic
969889019 4:10242550-10242572 ATAGCTTTGTCCTACTTCTGAGG + Intergenic
970399636 4:15704832-15704854 ACTGATTTTTGTTCCTTCTGTGG + Intronic
970502882 4:16696167-16696189 ATTGCTTTACATTCCTTCTCTGG - Intronic
971069196 4:23071596-23071618 ATTGATATCCCTTCCTTCTCAGG - Intergenic
971168246 4:24206214-24206236 TTTGCCTACACTTCCTTCTGTGG - Intergenic
971619610 4:28839044-28839066 CTTTCTTTCTTTTCCTTCTTAGG - Intergenic
971802208 4:31307059-31307081 CTTGCTTTTTCATCCTTCTCTGG - Intergenic
971903588 4:32696191-32696213 ATGTCTTCCTCATCCTTCTGTGG - Intergenic
972018601 4:34279946-34279968 ATTTCTTTGTCTTTCTTTTGAGG + Intergenic
973253957 4:48089824-48089846 ATTGATTTCTCTTTCTCCTTAGG - Exonic
973303278 4:48614260-48614282 ATTCTTTTCTCTTTCTTCTTTGG - Intronic
973578017 4:52312458-52312480 ATTGCTGTCTCTTTCTTCAAAGG - Intergenic
973723124 4:53745152-53745174 TTTCCTTTCTCTTCCTTCCTTGG - Intronic
974572729 4:63674992-63675014 AGTGCTTTCTCTAACTTCTAAGG + Intergenic
975376133 4:73648261-73648283 ATTTATTTATCTTTCTTCTGGGG + Intergenic
976812923 4:89116081-89116103 TTTTCTTTCTTTTCTTTCTGAGG - Intergenic
977516476 4:98026520-98026542 AGTGTATTTTCTTCCTTCTGTGG + Intronic
978344054 4:107747788-107747810 ATTGCTTCTTCTCACTTCTGTGG + Intergenic
978455137 4:108880524-108880546 ATTGTTATCTCTTTCTTTTGGGG - Intronic
978699490 4:111625764-111625786 TTTGTTTGCTCTTCCTTCTCTGG + Intergenic
979217538 4:118183352-118183374 TCTTCTTTCTCATCCTTCTGAGG + Intronic
981289348 4:143056405-143056427 ACTGCAATCTCTGCCTTCTGGGG + Intergenic
981810078 4:148763892-148763914 ATTGCTTTCTCTTGCTTGATTGG - Intergenic
982060556 4:151600439-151600461 AATGCCATCTATTCCTTCTGGGG - Intronic
982338208 4:154264456-154264478 CTGTCTTTCTCTTCATTCTGAGG - Intronic
982463362 4:155699279-155699301 ATTCCTCTCTTTTCCTGCTGAGG + Intronic
982502477 4:156174097-156174119 ATAACTTTCTGTTGCTTCTGAGG - Intergenic
982508372 4:156249423-156249445 ATATCTTTCTCTTCATTCTTGGG + Intergenic
983156800 4:164357873-164357895 ATTGTTTTCCTTTTCTTCTGAGG - Intronic
983286852 4:165750830-165750852 TTTGCTTTCTCTCACTTTTGTGG + Intergenic
983413802 4:167429727-167429749 TTTTCTTTCTCTTCCTTTTAAGG - Intergenic
983581440 4:169313404-169313426 CTTGCCTTGTCTTGCTTCTGGGG - Intergenic
983626956 4:169811580-169811602 AAAGCTTTCTCTCCCTTCTTAGG - Intergenic
984848351 4:184127915-184127937 AATGCTTTCTCTTCCTTCCCTGG - Intronic
984976837 4:185238422-185238444 AGTCCCTTCTCATCCTTCTGAGG + Intronic
985869616 5:2543902-2543924 CTCGCTCTCTCTTCCTTCAGAGG + Intergenic
986276699 5:6281463-6281485 CTTGCTTGCTGTTGCTTCTGCGG - Intergenic
986385528 5:7230054-7230076 CTAGCATTCTCTTCCTTCAGAGG + Intergenic
986755537 5:10832576-10832598 ATTTCTTTCTCATAGTTCTGGGG + Intergenic
987276388 5:16367500-16367522 TTTGCCTTCTTTTTCTTCTGAGG - Intergenic
987298337 5:16574204-16574226 TTTGCTTTCTCTTCCTGCTGAGG - Intronic
988357410 5:30196930-30196952 TTTCCCTTCTCTTCCTTCTCAGG + Intergenic
988622145 5:32833892-32833914 ATTTCCTTCTGTTCCTTCTGTGG - Intergenic
988839176 5:35066523-35066545 ATTCTTGTCTTTTCCTTCTGTGG + Intronic
989756019 5:44955441-44955463 AATGTTTTCTCTTCTTTCTGAGG + Intergenic
990655205 5:57947415-57947437 ATTGCTTTCTCATCCCTCCTAGG + Intergenic
990776453 5:59310556-59310578 AATTCTTTCTCTGCCTTTTGTGG + Intronic
990799708 5:59586867-59586889 ATTGCTTTTTCTTCTTTCTTAGG + Intronic
993359985 5:86963254-86963276 ATTTATTTCTCATACTTCTGGGG + Intergenic
993463264 5:88212050-88212072 TTTGCTTTATTTTTCTTCTGAGG - Intronic
993889843 5:93460396-93460418 ATTGCATTATATTCTTTCTGTGG - Intergenic
994612761 5:102065725-102065747 ATTGCTATTTCTTCCTTATTTGG - Intergenic
994763226 5:103883469-103883491 TTTGTTTTCTCTGCTTTCTGTGG - Intergenic
995262965 5:110126967-110126989 TTTGTTTTCTCTTGCTTCTCTGG + Intergenic
995409306 5:111836647-111836669 AATGCTCTCTCTCCCTTCTCTGG - Intronic
995683753 5:114748367-114748389 ATTGCTTTTTCTACGTTGTGAGG + Intergenic
995941441 5:117590054-117590076 ATTTTTTTCTCTTCCTTCAGTGG - Intergenic
996765928 5:127033865-127033887 TTTGTTATCTCTTCCTTCTTTGG + Intergenic
997014593 5:129918010-129918032 TTTGCTTTGTTTTCCTTTTGGGG + Intronic
997101748 5:130977238-130977260 ATTGCATTCTATACCTTCTATGG + Intergenic
997778214 5:136630265-136630287 CTCCCTTACTCTTCCTTCTGTGG - Intergenic
998848157 5:146330968-146330990 AATCCTTTCTCTTCCTTGGGGGG - Intronic
999031595 5:148299236-148299258 CTTGCTTTGTCCTCTTTCTGTGG + Intergenic
999268552 5:150282918-150282940 ATTGGAATGTCTTCCTTCTGTGG + Intronic
999498182 5:152120561-152120583 ATTGATGTCTCATCCTTCAGTGG + Intergenic
999999358 5:157122584-157122606 ATTCCTTTCTATTTCTTCTTTGG - Intronic
999999381 5:157122997-157123019 ATTCCTTTCTATTTCTTCTTTGG - Intronic
1000284187 5:159812400-159812422 ATTGCTTTCACTTTATTCTATGG + Intergenic
1000695994 5:164384588-164384610 AAAGCTTTTTCTTGCTTCTGAGG + Intergenic
1000921679 5:167145546-167145568 ATTTCTTTTTCTTCCTTCAGTGG + Intergenic
1001572467 5:172739204-172739226 GGTGCTTTCTCTTCCTACTGGGG + Intergenic
1001712601 5:173790433-173790455 ATGGTTTTGTCTTTCTTCTGGGG - Intergenic
1001869899 5:175143197-175143219 ATTTCTTTTTCTACCTTCTCTGG - Intergenic
1001981370 5:176040107-176040129 ATTCCTTCCTCTTCATTCTTTGG + Intergenic
1002236093 5:177803959-177803981 ATTCCTTCCTCTTCATTCTTTGG - Intergenic
1002475063 5:179460299-179460321 ACTGGTTTCTATGCCTTCTGGGG - Intergenic
1003707139 6:8545473-8545495 ATTCCTGTCTCATCATTCTGTGG - Intergenic
1003949178 6:11102603-11102625 TTTTCTTTGTCTTGCTTCTGTGG - Exonic
1004222535 6:13759080-13759102 ATGGCCTTCTCTTCCTCATGAGG - Intergenic
1004243775 6:13952732-13952754 CTTGCTTTCACTTTATTCTGTGG - Intronic
1004478896 6:16000248-16000270 CTTGCTATTTCTTCCTTCTCTGG + Intergenic
1005042736 6:21613969-21613991 CTTGCTTTCTGTTCCTTATAGGG - Intergenic
1005159518 6:22843023-22843045 ATTTCTCTCTCCTCCTTGTGAGG - Intergenic
1005419921 6:25638360-25638382 CTTGCTCTCTGTTCCATCTGTGG - Intergenic
1005576689 6:27196369-27196391 ATTGATTTCTCTTAGTTTTGTGG + Intergenic
1005605238 6:27470456-27470478 ATTGCTTCCTCTACTTTCTGAGG - Intronic
1005794004 6:29337981-29338003 AATGCTTTATGTTTCTTCTGTGG + Intergenic
1006583876 6:35092771-35092793 ATTCCTTTCTCCCCCTTCAGGGG + Intergenic
1007581708 6:42963836-42963858 ATTGTTTACCCTTCCGTCTGTGG - Exonic
1008000553 6:46355732-46355754 ATTTCATTCTCTGCCTTCTTTGG - Intronic
1008115484 6:47545014-47545036 TTTGCTTTGTATTCCTTCTAAGG - Intronic
1008839257 6:55879875-55879897 ATAGATTTTACTTCCTTCTGAGG - Intergenic
1008908126 6:56702901-56702923 AGAGCTTACTTTTCCTTCTGTGG - Intronic
1008911663 6:56740183-56740205 CTTGCTTTCACTTTATTCTGTGG + Intronic
1008934267 6:56972957-56972979 ATTTCTCTCTCTCTCTTCTGTGG + Intronic
1009217687 6:60943834-60943856 ATTACTCTCTTTTCCTTTTGGGG - Intergenic
1009483454 6:64190699-64190721 AATTTTCTCTCTTCCTTCTGTGG + Intronic
1009987860 6:70803545-70803567 TTTGTTTGCTCTTGCTTCTGTGG + Intronic
1010316208 6:74453618-74453640 AAAGCTTTTTCTTCCTTCGGGGG - Intergenic
1010331971 6:74633783-74633805 CTTTCTCTCTCTTCTTTCTGAGG + Intergenic
1011198252 6:84804966-84804988 CTTGCTTTCCCTTTCTTCTTTGG + Intergenic
1011891163 6:92161991-92162013 TTTTCTTTCTCTTTCTTCTTTGG - Intergenic
1012094425 6:94940770-94940792 ACTGCTTTGCCTTCCTTCTTTGG - Intergenic
1012243051 6:96896390-96896412 ATTATTTTCTCATTCTTCTGTGG - Intronic
1012473202 6:99593164-99593186 ATTGTTTTTTCTCTCTTCTGGGG - Intergenic
1012521916 6:100131805-100131827 ACTTCTCTCTCTTCCTCCTGAGG + Intergenic
1012550509 6:100461046-100461068 CCTCCTTTCTCTCCCTTCTGTGG - Intronic
1013842799 6:114418346-114418368 ATTGCTTTCTTCATCTTCTGTGG - Intergenic
1013990828 6:116252656-116252678 TCTGCTTTCTCTTCATACTGTGG - Exonic
1014662999 6:124197273-124197295 TTTTTTTTCTCTTCCTTCTATGG + Intronic
1014767460 6:125423164-125423186 TTTTCTTTGTCTTTCTTCTGAGG + Intergenic
1015060432 6:128958465-128958487 ATTCCTTTCCCTCCCTTCAGAGG + Intronic
1015823074 6:137283402-137283424 GTTGCATTGGCTTCCTTCTGTGG + Intergenic
1016384456 6:143516801-143516823 TTTGCTTCCTCTTCCTCTTGAGG - Intergenic
1016538297 6:145133932-145133954 AGGGCTTTCTCTTCCTTCCGAGG - Intergenic
1017738459 6:157383286-157383308 ATTGCTTTCTTTAAATTCTGAGG - Intronic
1017878830 6:158545567-158545589 CCTGCCTTCTCTGCCTTCTGGGG + Intronic
1017959304 6:159207988-159208010 ATTGCTTTCTTTGCTTTCTGTGG + Intronic
1018804574 6:167248883-167248905 TTTTCTTCCTCTTCCTTTTGGGG + Intergenic
1018825870 6:167407558-167407580 TTTTCTTCCTCTTCCTTTTGGGG + Intergenic
1021592704 7:22281211-22281233 ATTTCTTTCTTTTTCTTTTGAGG + Intronic
1022056155 7:26736616-26736638 CTTGCTTTCACTTCCCTCTACGG + Intronic
1022192743 7:28032935-28032957 GTTGCTTTCGCCTCCTTGTGGGG - Intronic
1023226961 7:37980111-37980133 AGTGCTCTCTCTTCAATCTGTGG - Intronic
1023508052 7:40920875-40920897 GTTCTTTTCTTTTCCTTCTGAGG - Intergenic
1024146526 7:46522807-46522829 ATTGCTTTCACCTTATTCTGTGG + Intergenic
1025870966 7:65433982-65434004 ATGGCTGTCTCTGCCTTCTCTGG - Intergenic
1026105456 7:67417430-67417452 ATTTCTCTCTCCTTCTTCTGAGG - Intergenic
1026244692 7:68608707-68608729 GTTGCTTATTCTCCCTTCTGTGG + Intergenic
1026472549 7:70706458-70706480 TTTGCTTTCCCTTCCTTCCAAGG - Intronic
1026842683 7:73679249-73679271 CTTTCTCCCTCTTCCTTCTGAGG - Intergenic
1028294275 7:89108045-89108067 ATTGCTTTCTCTTCCCTCTGTGG - Intronic
1028389248 7:90295685-90295707 ATTGCTTTCACTTTACTCTGTGG - Intronic
1029499090 7:100916749-100916771 CTTGCTTTCACTTCACTCTGTGG + Intergenic
1030624203 7:111826216-111826238 TGTGCTCTCTCTTGCTTCTGAGG - Intronic
1031937360 7:127749393-127749415 GTAGCTTTGGCTTCCTTCTGTGG + Intronic
1032136602 7:129285133-129285155 TTTGCTTTCTCTCCCATCTATGG + Intronic
1032136616 7:129285248-129285270 TTTTCTTTCTCTCCCATCTGAGG + Intronic
1032796502 7:135281392-135281414 ATTGCTGTCACTTTCATCTGTGG + Intergenic
1033074094 7:138232379-138232401 ATGCCTTTCTTTTCCTCCTGTGG - Intergenic
1034629764 7:152521946-152521968 CTTGCTCTCTCTTCATTCTTGGG - Intergenic
1036953713 8:13165055-13165077 ATTGGTTTCTCTTTCTACTAGGG + Intronic
1037399366 8:18478491-18478513 AATGCTTTTTTTTCCTTCTAAGG + Intergenic
1037678689 8:21074605-21074627 ATTGCTCTCTGTGGCTTCTGTGG - Intergenic
1038400931 8:27284069-27284091 TTTGCTTCCTCTTGCTTGTGGGG - Intergenic
1038703284 8:29871298-29871320 TTTGCTTTCTTTTTCCTCTGAGG - Intergenic
1038747953 8:30270432-30270454 ATTTCTTTTTCTGCCTTCTTCGG + Intergenic
1038961989 8:32530603-32530625 ATTCCTTTCTCTTTCCTCTCTGG + Intronic
1039216201 8:35274383-35274405 ATTATTTTCTCTCCCTTTTGAGG - Intronic
1040751790 8:50718430-50718452 ATTTGTTTCTCGTGCTTCTGTGG + Intronic
1040976671 8:53201045-53201067 ATTGCTGTCTGTTCCTTCTTTGG + Intergenic
1041031329 8:53738388-53738410 ATTGCTTTCTCTTCCTTCTGTGG - Intronic
1041171684 8:55148884-55148906 ATGGGTTTCTCTTCCTACTGAGG + Intronic
1041189891 8:55342687-55342709 CTTGCTTCCTCTTCCTCCTTTGG + Intronic
1041426398 8:57725479-57725501 CCTGCTGTCTCTTTCTTCTGCGG - Intergenic
1042100356 8:65269844-65269866 ATTTGTTTCTCTTCCTTCATGGG - Intergenic
1042570223 8:70156134-70156156 AGTGCATTCTCTTTCTTCTTGGG + Exonic
1046162377 8:110384301-110384323 AATACTTTCTATTCCTTCTGAGG - Intergenic
1047503170 8:125458006-125458028 ATGGCCTTATCTTCCTGCTGGGG + Intergenic
1047830146 8:128620679-128620701 TTGGCTTTATCTTCCTTCTCTGG + Intergenic
1047839032 8:128727742-128727764 ATTTCTTTCCTTTCCTTCTCTGG + Intergenic
1047843360 8:128778432-128778454 ATTGCTGAAACTTCCTTCTGGGG + Intergenic
1048075129 8:131061701-131061723 ATTGCTCATTCTTCCCTCTGAGG + Intergenic
1048164232 8:132048378-132048400 ATTGCTCTCAGTTCCTTCTGTGG - Intronic
1048847870 8:138616957-138616979 ACTCCATTCTCTTCCTTCTAGGG - Exonic
1049727341 8:144154371-144154393 ATGGCTTTCTTCTGCTTCTGGGG + Intronic
1049950414 9:638363-638385 TTTGCTTTCTCTTCCTACATGGG + Intronic
1050162243 9:2730931-2730953 ATTTTTTTTTCTTCCTTTTGTGG - Intronic
1050782150 9:9350650-9350672 ATTCCTTTCTGGTCCATCTGAGG - Intronic
1050892936 9:10848132-10848154 ATTGCTATCTGTTAATTCTGAGG + Intergenic
1051520175 9:17978429-17978451 ATTTCTTTCTCTTTATTTTGGGG + Intergenic
1051850076 9:21496067-21496089 ATTTCTCTCTCTCCCTTCAGAGG + Intergenic
1052723997 9:32207315-32207337 ATTTCTCTTTCTTCCTTGTGAGG + Intergenic
1053389179 9:37721229-37721251 TTTGCTATCTCTGCCTTATGTGG - Intronic
1053410527 9:37913663-37913685 ATGCCTTCCTCTTCCTTCTCTGG + Intronic
1054975308 9:71136763-71136785 GTGACTTTCTCTTACTTCTGTGG - Intronic
1055560356 9:77515985-77516007 ATGGCTGTCTCTTCCTGCTCTGG - Intronic
1057037390 9:91821249-91821271 TTTGCTTTCTCCTAATTCTGGGG - Intronic
1057976305 9:99609484-99609506 AATGCTTTATCTTCTTTCTGGGG + Intergenic
1058531843 9:105913714-105913736 ATTGCTTTCTATTAATTCTGAGG + Intergenic
1059127143 9:111700465-111700487 ATCTTTTTCTTTTCCTTCTGTGG + Intronic
1059208811 9:112491747-112491769 ATTGCTTTCCCTTGCTTCTCTGG + Intronic
1060337403 9:122738634-122738656 ATTGCTTTCTCTCCCTTTCTTGG + Intergenic
1061131728 9:128712354-128712376 ACTGCTTTCTCTACCCTTTGAGG + Intronic
1061533343 9:131231868-131231890 TTTGCTTCCTCTTCTTTTTGGGG - Intronic
1061729669 9:132604064-132604086 ACTGCTTTACCTTCCTTCTACGG - Intronic
1062311874 9:135942726-135942748 CTTTCTGTCTCTTCCTTCTTGGG - Intronic
1062664746 9:137663479-137663501 GTTTCTTTTTCTTTCTTCTGTGG - Intronic
1186434216 X:9529207-9529229 ATTGCTTTCTGTGTCCTCTGTGG + Intronic
1188545563 X:31301892-31301914 ATTTCTTTCCCTTCCTCCAGAGG - Intronic
1188657490 X:32716350-32716372 CCTGCTTTCTCCTCCTTCTCTGG + Intronic
1188730096 X:33635334-33635356 ATTGCCTAGGCTTCCTTCTGGGG + Intergenic
1189686899 X:43573835-43573857 ATTTCTTTTTCTGCCTCCTGGGG + Intergenic
1190256964 X:48770679-48770701 ATTGCTATCTCTGCCTTGAGTGG + Intronic
1190718440 X:53125544-53125566 ATTTTTTTCTATTCTTTCTGTGG + Intergenic
1191600340 X:62997879-62997901 ATTGCTGTCATTTCCTTGTGTGG + Intergenic
1193065866 X:77259189-77259211 TTTGTTTTCTCTTGCTTCTCTGG - Intergenic
1194265259 X:91745243-91745265 GTTGCTTTCTCCAGCTTCTGAGG - Intergenic
1194278672 X:91919629-91919651 ATTTCTTTCTCTTCCTGATAAGG - Intronic
1194358201 X:92915094-92915116 ATTGTTTACTCTTCCTGCTTAGG + Intergenic
1194557023 X:95372075-95372097 ATTGTTTTATCTTCCACCTGAGG - Intergenic
1194875823 X:99186769-99186791 CTTGCATTCTCTGCCCTCTGAGG - Intergenic
1194895794 X:99437855-99437877 ATTCCTTTCTCTTCCTCCTTTGG - Intergenic
1195060889 X:101193112-101193134 TTTGCTTTCTCTTCTTGCTTTGG + Intergenic
1195855336 X:109325864-109325886 TTTGATTTCTCTTCTTTCTTGGG - Intergenic
1196276882 X:113776584-113776606 ATTGTTTTTTTTTCCTTCTTGGG - Intergenic
1196720693 X:118851055-118851077 ATTTGTTTCTCTTCTTGCTGAGG + Intergenic
1197191177 X:123649109-123649131 ATTGTTGTCTTTTCCTTCTTCGG - Intronic
1197302678 X:124800650-124800672 TTTGTTTCCTCTTGCTTCTGTGG + Intronic
1197356626 X:125444200-125444222 TTTTCTTCCTCTTCTTTCTGTGG + Intergenic
1198062901 X:133064818-133064840 TTTGCTTGCTCTTGCTTCTCTGG - Intronic
1198666162 X:139025545-139025567 ACATCTTTCTGTTCCTTCTGTGG + Intronic
1199047136 X:143187983-143188005 TTTGCTTCTTCTTCCTTCTAGGG - Intergenic
1200481280 Y:3705852-3705874 CCTCCTTTCTCTTCCTTCTTTGG - Intergenic
1200582412 Y:4965691-4965713 GTTGCTTTCTCCAGCTTCTGAGG - Intergenic
1200596157 Y:5143132-5143154 ATTTCTTTCTCTTCCTGATAAGG - Intronic
1201928682 Y:19317615-19317637 AATTGTTTCTCTTCCTTCTGTGG + Intergenic