ID: 1041031330

View in Genome Browser
Species Human (GRCh38)
Location 8:53738416-53738438
Sequence AAAAACGAATTAACTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041031330_1041031331 2 Left 1041031330 8:53738416-53738438 CCAAAGCAAGTTAATTCGTTTTT 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041031330 Original CRISPR AAAAACGAATTAACTTGCTT TGG (reversed) Intronic
901759963 1:11464306-11464328 AAAAAAAAATTAACTGGCTGTGG - Intergenic
901826453 1:11864896-11864918 GAAATCTAATTAAGTTGCTTTGG - Intergenic
902762425 1:18591269-18591291 AAAAACGAATTAGCTGGGTGTGG - Intergenic
903434031 1:23332743-23332765 AAAAACAAAAAAACTTGGTTGGG + Intronic
903712149 1:25334149-25334171 AGGAAGTAATTAACTTGCTTTGG - Intronic
905072577 1:35240219-35240241 AAAGGCGAAGTAACTTGCTAAGG - Intergenic
905483842 1:38281772-38281794 AAAAAAAAAAAAACTTGCTTTGG + Intergenic
905699677 1:40001989-40002011 AAAAAAAAATTAATTTGCTAGGG + Intergenic
906447734 1:45917887-45917909 ACAAACCATTTAACTTGTTTTGG - Intronic
906471460 1:46134011-46134033 AACAGCTAATTAACTTGCTGGGG + Intronic
907233112 1:53019456-53019478 AAAAATGAATCAACTTGATCAGG - Intronic
907579342 1:55557568-55557590 AAAGATGAAGTAACTTGCTGGGG - Intergenic
909168898 1:72268369-72268391 AAAAACCAAATAACTTGCTGTGG + Intronic
909896189 1:81072340-81072362 AATAAATAATAAACTTGCTTTGG - Intergenic
910043825 1:82888010-82888032 AAAAAGGAGCTAACTTACTTGGG - Intergenic
910172214 1:84389523-84389545 AAAAATTAAGTAACTTGCCTAGG - Intronic
910177988 1:84451706-84451728 AAAAATCAAGTTACTTGCTTAGG - Intergenic
910504948 1:87939778-87939800 AACAACAAAAAAACTTGCTTTGG - Intergenic
910586160 1:88881820-88881842 AAAACAAAATTAACTTCCTTTGG + Intronic
911378433 1:97080636-97080658 AAAAACGATTTATCTTCCTTAGG + Intronic
911384256 1:97154975-97154997 TAAAACACATTAACTTACTTAGG - Intronic
912674252 1:111662410-111662432 AAAAAAAAATTAACTTGATCAGG + Intronic
913065182 1:115245568-115245590 AAATACAAATTAATGTGCTTAGG + Intergenic
913175589 1:116270188-116270210 AAAGATGAATTTACTGGCTTAGG + Intergenic
916235947 1:162588388-162588410 AAAAACGCATTAAGTTACTATGG - Intronic
916769423 1:167893822-167893844 AAAATTGAATTTACTGGCTTTGG - Intronic
916772758 1:167928820-167928842 ATAAATGAAATAACTTGATTAGG + Intronic
916855218 1:168742068-168742090 AAACACTAATTAATTTGCTGAGG - Intergenic
917226622 1:172790315-172790337 AAAAACTGATTAAATTGATTGGG - Intergenic
917824501 1:178803413-178803435 AAAAACGAATTCAGTTACTTAGG + Intronic
920189739 1:204185878-204185900 AAAAACAAAATAAATTGGTTAGG - Intergenic
921446341 1:215251119-215251141 ACAAAGGAATTAACTTGGTATGG + Intergenic
921478721 1:215639342-215639364 TAAAACGTCATAACTTGCTTTGG - Intronic
921757600 1:218878306-218878328 AAAAATGAATTAATTGGATTTGG - Intergenic
922300075 1:224291195-224291217 AAAAAAGAATTAACATTCATTGG - Intronic
923705416 1:236340470-236340492 AAGATCAAATTAACATGCTTGGG - Intergenic
923882586 1:238119698-238119720 AAAAGGCAATTAACTTTCTTGGG + Intergenic
924169568 1:241323966-241323988 AGAGACTAAATAACTTGCTTAGG - Intronic
924402986 1:243708368-243708390 AAAAATGAATTTACTTACCTTGG + Intronic
924765561 1:247028992-247029014 AAAAAAGAATGTACTTGTTTAGG + Intergenic
1066266483 10:33780684-33780706 AAAAAAGTAATAACTTGATTTGG + Intergenic
1066574643 10:36812009-36812031 AAAAATCAGTTAACTTTCTTTGG + Intergenic
1066990343 10:42507237-42507259 AAAAATGAATGTACTTGTTTAGG - Intergenic
1068756026 10:60653868-60653890 AAAAACAAACAAAATTGCTTTGG + Intronic
1069038690 10:63672388-63672410 AAAAACGTATTGTCTTGGTTTGG + Intergenic
1069491244 10:68862845-68862867 AAAAATGAATGTACTTGTTTGGG - Intronic
1072049807 10:91692072-91692094 AAAGAAAAATTAGCTTGCTTTGG + Intergenic
1072398044 10:95065638-95065660 AAAAATGAATTTCCTTCCTTTGG + Intronic
1074949061 10:118311208-118311230 AAAAAAGAAGAAACTTGCATGGG - Exonic
1081197167 11:40175839-40175861 AAAAAAGAATTAAATGACTTAGG - Intronic
1081897547 11:46599494-46599516 AAAAAAGAATTAACTGGGTATGG + Intergenic
1082917321 11:58451434-58451456 AAAGATGAAATAACTTGCTGTGG + Intergenic
1083449412 11:62732618-62732640 AAAAAAAAATTAATTTACTTGGG + Intronic
1084305482 11:68280262-68280284 AAAAAAGAATCAACTTTATTGGG - Intergenic
1085159374 11:74326747-74326769 AAAAGAGAATGAACTTGTTTTGG + Intergenic
1085295288 11:75428197-75428219 TAATACGAATTGACTTCCTTAGG + Intronic
1085956463 11:81402658-81402680 AATAATGATTTAACTGGCTTTGG + Intergenic
1086138981 11:83473486-83473508 AAAAACCAATTTACTTTCTATGG - Intronic
1086889467 11:92239777-92239799 AAAACGGCATTAACTTGATTAGG + Intergenic
1087661549 11:100994687-100994709 AAAAATGAATTAACTTCCAGTGG + Intergenic
1088341550 11:108773798-108773820 AAAAACTCATTTAATTGCTTTGG + Intronic
1090008526 11:123024298-123024320 AAAAAAGAATTAAGTAACTTTGG + Intergenic
1090643985 11:128752658-128752680 AAAAGTGAAATAACTTGCTCAGG - Intronic
1091003188 11:131928378-131928400 AAAAACAAGTTAAAATGCTTAGG + Intronic
1093124307 12:15309664-15309686 AAAAAGTGATTCACTTGCTTTGG - Intronic
1094104712 12:26798641-26798663 AAACATGAATTAACATCCTTGGG - Intronic
1095075988 12:37926177-37926199 AAAAAGGAAATAACTAACTTTGG - Intergenic
1095184888 12:39190045-39190067 AAAAATGAACCAACTTGTTTAGG - Intergenic
1095753341 12:45734579-45734601 AAAAAAAAATTAAATGGCTTAGG + Intronic
1095837707 12:46656260-46656282 CAAAACAAATTAACTGGGTTTGG - Intergenic
1095942151 12:47734374-47734396 AAAAAGGAATTTATATGCTTGGG + Intergenic
1096307731 12:50493006-50493028 AAAAATGAATGTACTTGTTTAGG - Intergenic
1096751687 12:53763333-53763355 TAAAACAAATTAACTTTCTAAGG + Intergenic
1097500558 12:60395394-60395416 AAAAAAGTATTGAGTTGCTTTGG - Intergenic
1097940510 12:65299483-65299505 AAAGACAAAGTCACTTGCTTTGG - Intronic
1098098290 12:66984596-66984618 AAAAACTAAGTAACTTGCCCAGG + Intergenic
1098539775 12:71641242-71641264 TAACACAATTTAACTTGCTTTGG - Intronic
1098953616 12:76666554-76666576 AAAAATTACTTCACTTGCTTAGG + Intergenic
1100449438 12:94691206-94691228 AAAAATGAAGTTCCTTGCTTTGG - Intergenic
1101313190 12:103603039-103603061 AAAAAAGAATTAACTTGGAATGG - Intronic
1101501048 12:105303976-105303998 AAAAATGAATGTACTTGTTTAGG - Intronic
1102814894 12:115857776-115857798 AAAACCTAAGTAACTTGCTCAGG - Intergenic
1106367499 13:29096643-29096665 ACAAAGGAATTAACTTTGTTTGG - Intronic
1107607865 13:42079546-42079568 AAAAATGATTTCAGTTGCTTTGG + Intronic
1107641447 13:42447522-42447544 ATAAAGGAACTAACATGCTTGGG + Intergenic
1108341994 13:49506244-49506266 AAAAAAAAATTAGCTGGCTTTGG + Intronic
1108486139 13:50927756-50927778 AAAAACAGATTAATTTTCTTTGG + Intronic
1110092073 13:71464923-71464945 GAAAAGCAATTAATTTGCTTTGG + Intronic
1110577906 13:77081253-77081275 AAAAACAAATTAATATGATTGGG - Intronic
1110960890 13:81624159-81624181 AAAATAGAATTAACTTGCTTTGG + Intergenic
1111801765 13:92989642-92989664 AAAAACAAAATATCTTGCCTGGG + Intergenic
1112747342 13:102541447-102541469 AAAAAAAAATTACCTTGCTGTGG + Intergenic
1115424286 14:33238055-33238077 AAAAATGAACTAACGTGTTTTGG + Intronic
1115427435 14:33276590-33276612 AAAAAAGAAGTAACTTATTTAGG - Intronic
1116129201 14:40832472-40832494 ATAAACGAATTATTTTTCTTTGG + Intergenic
1116139776 14:40976997-40977019 AAAAATAAATTAACTGGGTTTGG - Intergenic
1116238175 14:42308213-42308235 AAAAATGAATGTACTTGTTTGGG - Intergenic
1118252462 14:64174912-64174934 AAAAGAGAAGTAATTTGCTTAGG - Intronic
1119003548 14:70904891-70904913 AAATACTAATTAACTGACTTAGG - Intergenic
1119049697 14:71354751-71354773 CAAAGCAAATCAACTTGCTTAGG - Intronic
1122583665 14:102788502-102788524 AATAAAGAATTAGCTTGGTTGGG + Intronic
1122616101 14:103019094-103019116 AAAAAAGAATTAGCTGGCATGGG - Intronic
1123193164 14:106591084-106591106 AAAAAGGAATTAAATGGATTAGG + Intergenic
1124837432 15:33208971-33208993 AAAAACCAATTATCTTTTTTTGG - Intergenic
1125735483 15:41922231-41922253 AAAAACAAATTAACTGGGTGTGG + Intronic
1127504172 15:59582156-59582178 AAAAATGAATTAACTAGGTGTGG - Intergenic
1128869876 15:71146493-71146515 AAAAATGAAGTTAATTGCTTTGG - Intronic
1129549313 15:76430667-76430689 AAGAAGTAACTAACTTGCTTTGG + Intronic
1133542610 16:6771023-6771045 AAACCCGAATTAACTTCCTAAGG - Intronic
1133800771 16:9083267-9083289 AAAAAAAAATTAACTTGGCTCGG + Intergenic
1134565198 16:15245918-15245940 AGAAACCAAGTAACTTGCTCAGG - Intergenic
1134737298 16:16510780-16510802 AGAAACCAAGTAACTTGCTCAGG + Intergenic
1134930220 16:18201371-18201393 AGAAACCAAGTAACTTGCTCAGG - Intergenic
1136743615 16:32562649-32562671 AGAAAAGAATTCATTTGCTTTGG + Intergenic
1136922142 16:34342138-34342160 AAAAATGAATGTACTTGTTTAGG + Intergenic
1136982431 16:35069668-35069690 AAAAATGAATGTACTTGTTTAGG - Intergenic
1138806708 16:60098967-60098989 AAAAAAGAATGAACATGCCTAGG - Intergenic
1139002112 16:62524721-62524743 ATAAACCAATTAACTTCCTGTGG + Intergenic
1139176417 16:64694642-64694664 AAAATCAAATTAAGTTGCTTAGG + Intergenic
1139622576 16:68158652-68158674 AAAGAAGAAAAAACTTGCTTGGG - Intronic
1140315244 16:73889924-73889946 AAAAACTAATGGAGTTGCTTTGG + Intergenic
1203025984 16_KI270728v1_random:512580-512602 AGAAAAGAATTCATTTGCTTTGG - Intergenic
1203045737 16_KI270728v1_random:821851-821873 AGAAAAGAATTCATTTGCTTTGG + Intergenic
1144544955 17:16185704-16185726 AAAAAAGAATTAACTATTTTGGG + Intronic
1145727212 17:27141520-27141542 GAAAACAAATTGAGTTGCTTGGG + Intergenic
1145778549 17:27546380-27546402 AAAAATTAATTATCTTCCTTGGG + Intronic
1146390581 17:32418463-32418485 AAAAAAGAATGAAATTGGTTGGG - Intergenic
1148593173 17:48831506-48831528 AAAAAGAAAGTAACTTGCTCAGG - Intronic
1148846044 17:50530639-50530661 AAAAAAGAATCAACTTGTCTGGG + Intronic
1150610462 17:66729246-66729268 AAAAAAAAATTAGCTTGGTTTGG + Intronic
1151704674 17:75760618-75760640 AAAAAAAAATTAACTCGCTCTGG + Intronic
1154236526 18:12611132-12611154 AAAAACAAAAAAACTTGCTAGGG + Intronic
1155316534 18:24577356-24577378 AGACATGAATTAACTCGCTTGGG + Intergenic
1155496424 18:26447281-26447303 AAAAACCAATTAAGATCCTTTGG + Intergenic
1156182732 18:34625022-34625044 AAAAAAAAATTAACTGGCTGTGG - Intronic
1156594115 18:38526113-38526135 AAAAACTAATTAATGTGCTGAGG + Intergenic
1157637287 18:49171033-49171055 AAAAACGAAGTCACTGGATTTGG + Intronic
1157652233 18:49345232-49345254 AAAAAAGAAATGACTTGCCTTGG - Intronic
1158428652 18:57363182-57363204 AAAAACCAATTAAGTTGCAGAGG + Exonic
1158999696 18:62961759-62961781 AACAAGGTATTAACTTGATTTGG + Intronic
1159637963 18:70828578-70828600 AAAAAGTAATTATGTTGCTTAGG - Intergenic
1162242004 19:9362819-9362841 ACAAGCCAATTAACTTGCTTGGG - Intronic
1163439991 19:17317684-17317706 AAAAACAAATTAGCTGGCTGTGG + Intronic
1165564474 19:36712747-36712769 AAAAAAGACTTAAGTTGATTGGG - Intronic
1166048600 19:40244422-40244444 AAAAACAAAATAATTTTCTTTGG + Intronic
1166838203 19:45680369-45680391 AAAAAAAAATTAACTTGGTGTGG + Intronic
1167615899 19:50533380-50533402 AGAGAAGAATTAACTGGCTTTGG - Intronic
926857149 2:17269500-17269522 GAAGACAAATTAACTAGCTTTGG + Intergenic
927408456 2:22798526-22798548 AAAGATGAAATAACTTGCTGTGG + Intergenic
928248952 2:29657908-29657930 AAAAATTAATTAACTTGCTGTGG - Intronic
929031595 2:37654426-37654448 GAAAAGGAATTAACTTGTTCTGG + Intronic
929692367 2:44085562-44085584 AAAAAAAATTTAACTTTCTTTGG + Intergenic
929891363 2:45921103-45921125 AAAATCGAAATAAACTGCTTAGG + Intronic
930142562 2:47967584-47967606 GAAAATGAACTAATTTGCTTTGG - Intergenic
930377324 2:50584218-50584240 AAAAATAAAATAACTTTCTTAGG - Intronic
930926508 2:56824424-56824446 CAAAACAAATTAATTTGCTCTGG + Intergenic
931485611 2:62688095-62688117 AAAAATGAATTATCTCTCTTGGG + Intronic
932606211 2:73167390-73167412 AAAAACAAATTAGCTGGGTTTGG - Intergenic
933500611 2:83106514-83106536 AACAACTTGTTAACTTGCTTTGG + Intergenic
933612072 2:84446538-84446560 ACAAATTAATTAACATGCTTGGG - Intronic
933926217 2:87093060-87093082 AAAAACAAATTAGCTGGGTTTGG + Intergenic
935469187 2:103436519-103436541 AAAGAGGAAGGAACTTGCTTAGG - Intergenic
935559640 2:104547092-104547114 AAAAACGAATTGACTTCCTCTGG - Intergenic
939534019 2:143402475-143402497 ACAAAAGAATTAACCTGCTTGGG + Intronic
939731442 2:145789397-145789419 AAAACTGATTTATCTTGCTTAGG - Intergenic
939950988 2:148472437-148472459 AAATACTAATTAACGTGCATAGG + Intronic
940612709 2:156010507-156010529 AAAAACCCATTAAATGGCTTTGG + Intergenic
940918224 2:159281495-159281517 AAAAACCAATTAATTTACATTGG - Intronic
942995371 2:182253832-182253854 AGAAAGTAATTGACTTGCTTAGG - Intronic
943062255 2:183051424-183051446 AAAAATGAATGTACTTGTTTAGG - Intergenic
943259304 2:185638458-185638480 AATAACAAATTAGCTTGCCTGGG + Intergenic
943590754 2:189793497-189793519 AAAAACAAATTGTCTTTCTTTGG - Intronic
943968165 2:194366220-194366242 TAAAATAAATTAACTAGCTTGGG + Intergenic
944026930 2:195181711-195181733 AAAAAAGAATAAATTTGCCTTGG - Intergenic
944051681 2:195476928-195476950 AAAAAAGAATTAGCTTGGTGTGG - Intergenic
945495191 2:210500433-210500455 AGGAAGGAACTAACTTGCTTTGG - Intronic
946667273 2:222064214-222064236 AAAGGACAATTAACTTGCTTAGG + Intergenic
1169657193 20:7938361-7938383 AAAAATCAATCAACTTTCTTTGG - Intronic
1171166966 20:22980615-22980637 TAAAACGGAATAACTTGCCTTGG + Intergenic
1171233759 20:23508358-23508380 AAAAAAGAATTATCTGGCTGTGG - Intergenic
1172617454 20:36298592-36298614 AAAAATGCATTTACTTACTTGGG + Intergenic
1173994652 20:47328460-47328482 AAAAAAGAATTAACTTTTTGTGG - Intronic
1175097067 20:56549622-56549644 AAAAACGCATTAAGTAACTTTGG - Intergenic
1177324841 21:19572097-19572119 AAACACGAGTTAACTTTCTATGG + Intergenic
1177807040 21:25884695-25884717 TAAAAAAAATTATCTTGCTTAGG + Intronic
1180238309 21:46479680-46479702 AAAAACCAATTAGCTGGCTGTGG - Intronic
1180931919 22:19598132-19598154 TAAAACAAGTGAACTTGCTTTGG - Intergenic
1183267399 22:36837301-36837323 AAAAAAGAATTAAATTGCAGTGG + Intergenic
1184106518 22:42370472-42370494 AAAAACAAAAAAACTTACTTCGG + Intergenic
1184154983 22:42661639-42661661 AAAATTGAATTAACTTGGCTGGG + Intergenic
949314322 3:2734721-2734743 AAAAAAGAATAAAGTTGGTTTGG - Intronic
951671814 3:25191641-25191663 AATAACTAAGTAACTTGCATTGG + Intronic
952461846 3:33535482-33535504 AAAAATGAGTTAATTTGCTGTGG - Intronic
952497156 3:33925813-33925835 AAGAACAAATTAACCTGCTTTGG + Intergenic
952649005 3:35700148-35700170 ATAAAATACTTAACTTGCTTGGG - Intronic
952834174 3:37590118-37590140 AAAAAGGAGTTACATTGCTTTGG + Intronic
953011811 3:39033180-39033202 AAAACTTAATTAACTTGCTCAGG + Intergenic
953240839 3:41148110-41148132 AAAAACGATTTAAATTACCTGGG + Intergenic
953756811 3:45653573-45653595 AAAAACAAATCAATTTGGTTTGG - Intronic
953868482 3:46605434-46605456 CAAAACTAATTAACTAGCATGGG + Intronic
955118000 3:56025090-56025112 AAAAAAGAAAAAGCTTGCTTGGG + Intronic
956319364 3:67979322-67979344 AAAATCGAATTAAATTCCCTGGG - Intergenic
956486627 3:69729689-69729711 AAAAATGAACTATATTGCTTAGG + Intergenic
957110574 3:75951058-75951080 AAAAAAGAGTTAACTTTCTATGG - Intronic
957660832 3:83150092-83150114 AAAAAAGAAGTATCTTGTTTAGG + Intergenic
958921211 3:100107887-100107909 AAAAAAAAAGTTACTTGCTTAGG + Intronic
958998882 3:100938887-100938909 TAAAAGGAATTAAATTGCTTTGG + Intronic
959067000 3:101667645-101667667 AAAAAAGAATTAGCTTTCCTAGG - Intronic
959205004 3:103296448-103296470 AAAATAAAATTAACGTGCTTTGG + Intergenic
959285915 3:104410685-104410707 AATAATGAATAAATTTGCTTAGG - Intergenic
960341454 3:116479628-116479650 AAGAAGTAACTAACTTGCTTTGG + Intronic
960901021 3:122554641-122554663 AAAGATAAAGTAACTTGCTTTGG + Intronic
961226665 3:125255935-125255957 AAAAAAAATTTAACCTGCTTGGG + Intronic
961407233 3:126689002-126689024 AAAAAAAAATTAAATTACTTAGG - Intergenic
964896131 3:161598555-161598577 AAAAACTAATTTACTTTATTGGG + Intergenic
965880065 3:173378368-173378390 AAAAAATAATTTACTTTCTTGGG - Intergenic
966621760 3:181972245-181972267 AAAAAGGAAATAACTTATTTTGG + Intergenic
966806518 3:183811847-183811869 AAACAGGAATTACGTTGCTTGGG - Exonic
966967880 3:185013930-185013952 AAAAATGAATGTACTTGTTTGGG - Intronic
967816794 3:193806190-193806212 AAAAACGAAAAAAATTGCTGGGG + Intergenic
970763903 4:19523607-19523629 AAAAAAGGATGAACTTGATTTGG - Intergenic
970863972 4:20737974-20737996 AAAAACAAATTAACTGGGTATGG + Intronic
970979523 4:22080283-22080305 AAACAGGAATTAACATTCTTAGG + Intergenic
971858177 4:32070545-32070567 GAAAACTAAACAACTTGCTTTGG - Intergenic
972032775 4:34482832-34482854 AAAAATGAATTAACTGGAGTTGG + Intergenic
975207983 4:71666107-71666129 TAAAACAAATTACCTTCCTTAGG + Intergenic
975969086 4:80012323-80012345 AAAAAGGTATTAGCTTGCTGGGG - Intronic
976434376 4:85000093-85000115 ACAACCAAATTAACTTGTTTGGG - Intergenic
976567604 4:86569457-86569479 AAATACGATTTAATTTTCTTTGG - Intronic
976986518 4:91306571-91306593 AATAAAGAATTAACGTGTTTAGG - Intronic
977014753 4:91678506-91678528 AGAAAGTAACTAACTTGCTTTGG + Intergenic
977443312 4:97098042-97098064 AAAAATGAATGTACTTGTTTGGG - Intergenic
977452112 4:97212221-97212243 AAAAAAGAATTAAGTTCCTATGG - Intronic
978182246 4:105813106-105813128 AATAATGAAGTAGCTTGCTTTGG - Intronic
978635759 4:110803587-110803609 ACAAACGGTTTAAATTGCTTGGG + Intergenic
978861986 4:113461239-113461261 AAAAACCAATGAGCTTTCTTTGG + Intronic
979344253 4:119567739-119567761 AAACAGGAATTAACATGCTGAGG + Intronic
980139023 4:128893888-128893910 AAAAAATAAGTAACTTGCCTAGG + Intronic
980221181 4:129918253-129918275 AAAAAGGAAATTACTTGCTGTGG - Intergenic
981197528 4:141939000-141939022 AAAAATGAATGTACTTGTTTGGG - Intergenic
981399476 4:144296515-144296537 AAACACTAATTTACTTTCTTAGG + Intergenic
981823174 4:148909452-148909474 AAAGATGAATTCACTTGCCTAGG - Intergenic
982629235 4:157810769-157810791 GAAAATGAAATAACTTGCTCAGG - Intergenic
983174256 4:164569528-164569550 AGAAAGTAATTAACTTGGTTGGG - Intergenic
984032884 4:174626600-174626622 AAACAAGAATTTAATTGCTTTGG - Intergenic
984668996 4:182461182-182461204 AAAAGCAAATTATCTTGCTTGGG + Intronic
984715238 4:182918272-182918294 AAAACCAGATTAAGTTGCTTGGG - Intergenic
988144056 5:27281082-27281104 AAAAAAGTCTTACCTTGCTTTGG - Intergenic
988684118 5:33511624-33511646 AAAAATGAATTAACTGGGTATGG - Intergenic
989659379 5:43782903-43782925 AGAAACTCATTAACTTTCTTAGG - Intergenic
989826364 5:45861480-45861502 AAATACTAGTTAACTTGCCTGGG + Intergenic
989922169 5:49820097-49820119 AAAAAGGAAATATCTTGCCTGGG + Intergenic
991067197 5:62436271-62436293 ACAAAGGAATTCATTTGCTTTGG + Intronic
993085646 5:83360514-83360536 CAAAATCCATTAACTTGCTTTGG + Intergenic
993406632 5:87519158-87519180 AAAAATGAATGTACTTGTTTAGG + Intergenic
993642848 5:90426740-90426762 AAAAGCAAAGTAACTTGCCTAGG - Intergenic
993725755 5:91364712-91364734 AAAAAGCAATAAAGTTGCTTTGG - Intergenic
994217192 5:97151026-97151048 AAAAAAGAATTAACTGGGTGTGG + Intronic
995396876 5:111696578-111696600 AAAGCTGAATTAACTTGCTAGGG + Intronic
996808874 5:127490964-127490986 AAAATCGAATTAACCATCTTGGG + Intergenic
997534290 5:134605397-134605419 AAAAAAGAATTCAGTTTCTTAGG + Exonic
999041022 5:148412696-148412718 AAATGAGAATTAACTTGCTTAGG - Intronic
1000865578 5:166510729-166510751 AAAAATGAAATGACTTGCTCAGG + Intergenic
1000996636 5:167965948-167965970 AACAACAAATTAATTTGCTTAGG + Intronic
1001785896 5:174412855-174412877 ATAAGCCACTTAACTTGCTTTGG - Intergenic
1003669285 6:8140866-8140888 AAACAGTAGTTAACTTGCTTTGG + Intergenic
1007420692 6:41717521-41717543 GAAATGGAATTAACTTGCTAGGG + Intronic
1007504561 6:42325576-42325598 AAAAAAGAATGAAATTGGTTGGG + Intronic
1008519576 6:52350274-52350296 AAAAAAGAAATAACTTATTTGGG + Intergenic
1013418610 6:109946515-109946537 AAAAACAAAAAAACTTTCTTTGG - Intergenic
1014917885 6:127175298-127175320 ACAAACTAAGTAACATGCTTTGG - Intronic
1015022883 6:128498062-128498084 AAAAAACAATTAATTTTCTTAGG + Intronic
1015194894 6:130515012-130515034 AAAAATGAATTAACATGGATTGG + Intergenic
1016192832 6:141291909-141291931 AAAAACATATTAATTTGCCTAGG - Intergenic
1017375438 6:153762482-153762504 AGGAAAGAACTAACTTGCTTTGG - Intergenic
1018475994 6:164142360-164142382 AATAAAGAATTAATTTTCTTAGG + Intergenic
1019098110 6:169603135-169603157 AAAAAAGAATTATCTTGGCTAGG - Intronic
1019234021 6:170594230-170594252 AAAAATGAATGTACTTGTTTAGG - Intergenic
1020122940 7:5515552-5515574 GAAAATGAATACACTTGCTTAGG - Intergenic
1020138882 7:5601682-5601704 AAAAAAAAATTAACTTGATGTGG + Intronic
1020531763 7:9346886-9346908 ATTAAAGAATTAATTTGCTTAGG + Intergenic
1020731689 7:11888603-11888625 AGGAAGTAATTAACTTGCTTTGG + Intergenic
1021213072 7:17880323-17880345 GAAAACCAAGTCACTTGCTTTGG - Intronic
1021312919 7:19115658-19115680 AAAAAAGAATTAACTGACTATGG + Exonic
1022227556 7:28379335-28379357 ATAAACAAATTGAATTGCTTTGG - Intronic
1022373632 7:29792557-29792579 AAAACAGAATTTCCTTGCTTCGG - Intergenic
1023970627 7:44988226-44988248 ACAAACCACTTAACTTGTTTGGG - Intergenic
1024514130 7:50229757-50229779 AGAAACAAATTACCTTGCTTTGG + Intergenic
1025819585 7:64949626-64949648 AAAAATGAATGTACTTGTTTGGG + Intergenic
1026677249 7:72438127-72438149 AAAAACGAATTAGCTGGGTGTGG - Intronic
1027136914 7:75631114-75631136 AAAAACAAATTATCTGGGTTTGG - Intronic
1027351212 7:77313397-77313419 AAAAGAGCATTTACTTGCTTTGG - Intronic
1028003766 7:85535656-85535678 AAAAATGTATTAAGTTGATTAGG - Intergenic
1028065122 7:86375093-86375115 AAAAATGAATAAAATAGCTTTGG + Intergenic
1028926350 7:96360571-96360593 AAAAATTAATTAAATTGCTTAGG + Intergenic
1029997252 7:105019153-105019175 AAAATCTAATTAACTTACTCTGG - Intronic
1030532923 7:110732628-110732650 AAAAACCAGTTATTTTGCTTAGG - Intronic
1032886117 7:136140517-136140539 AAAATCAAATTAAATTGTTTGGG + Intergenic
1032962208 7:137049149-137049171 GAAAACTAAGTAAATTGCTTAGG + Intergenic
1033202938 7:139389998-139390020 AAAAAAAAATTAACTTGGTGTGG + Intronic
1036828814 8:12003962-12003984 TAAAATGAATTATCCTGCTTGGG + Intergenic
1036834042 8:12043914-12043936 TAAAATGAATTATCCTGCTTGGG + Intergenic
1036855887 8:12290479-12290501 TAAAATGAATTATCCTGCTTGGG + Intergenic
1037510938 8:19581792-19581814 AAAAACGGATTATCTTGATATGG + Intronic
1037659962 8:20918010-20918032 AAAAAAGAAATAGCTTGCCTTGG + Intergenic
1038117065 8:24568879-24568901 AAAAACTAATAAACTAGTTTTGG - Intergenic
1038763564 8:30406870-30406892 AAAAAAGACTTAACTGGCATTGG - Intronic
1039223136 8:35357509-35357531 AAATTAGAATTAACCTGCTTCGG - Intronic
1039545307 8:38405904-38405926 AAAAAGCCAATAACTTGCTTAGG - Intronic
1040495737 8:47963916-47963938 AAATATGATTTAACTTACTTTGG + Intronic
1040528499 8:48245588-48245610 AAAAATGAATGTACTTGTTTAGG - Intergenic
1040600203 8:48876042-48876064 AAAAAATAATTAATTTGATTTGG + Intergenic
1040677016 8:49762688-49762710 AAAAATAAATTAACTGCCTTGGG + Intergenic
1041019366 8:53622916-53622938 AAAAATGAATGTACTTGTTTAGG + Intergenic
1041031330 8:53738416-53738438 AAAAACGAATTAACTTGCTTTGG - Intronic
1041078555 8:54191518-54191540 AATAGTGAATTAACTTGGTTAGG + Intergenic
1041125174 8:54629902-54629924 AAAAAAGAATTAACTTCTTGGGG + Exonic
1041413297 8:57580247-57580269 AAAAATTAAATAACTTGCTAGGG + Intergenic
1043143278 8:76618083-76618105 ATAAACAAATTAGCTTGCTGTGG + Intergenic
1044490507 8:92808595-92808617 ATGAATAAATTAACTTGCTTAGG - Intergenic
1046650902 8:116835530-116835552 AAAAAAAAATTGATTTGCTTTGG + Intronic
1046791211 8:118324046-118324068 AAAAATGAATGAGCTTTCTTTGG - Intronic
1046881463 8:119313259-119313281 AAAATCTAAGTAACTGGCTTGGG + Intergenic
1047507265 8:125489633-125489655 AAGATTGTATTAACTTGCTTTGG - Intergenic
1048396921 8:134022704-134022726 AAAAACGAATTCACATGAGTGGG + Intergenic
1049933897 9:482248-482270 AAAATTCAATTAATTTGCTTGGG - Intronic
1050554069 9:6773845-6773867 AAAATGGAAATAACTTGCCTAGG - Intronic
1051577378 9:18632499-18632521 AAAAATGAATGAATATGCTTTGG + Intronic
1053366096 9:37523555-37523577 AAAAAAGAATAAACTAGCTTTGG + Intronic
1053728341 9:41026764-41026786 AAAAAAGAAAGATCTTGCTTTGG + Intergenic
1054700163 9:68405316-68405338 AAAAAAGAAAGATCTTGCTTTGG - Intronic
1054851060 9:69847159-69847181 CAAAAGGAAATAACTTGCTGTGG + Intronic
1055102077 9:72476189-72476211 AAAAACAAATTAGCTGGGTTTGG + Intergenic
1055685321 9:78767165-78767187 AAAAATGAATTAAATGTCTTTGG + Intergenic
1055779829 9:79808308-79808330 AAAAAGGAATTATCCTACTTAGG - Intergenic
1056218211 9:84425587-84425609 AAAAAGGAACTAACATTCTTAGG - Intergenic
1060455826 9:123795138-123795160 AAAAATGTATTATATTGCTTTGG - Intronic
1186661829 X:11675687-11675709 AAATAATAATTAACTTGATTTGG + Intergenic
1188052800 X:25508319-25508341 AAAAGTGAAGTAACTTGCTCAGG - Intergenic
1188232479 X:27682122-27682144 AAAAACGAAATAAATTAGTTTGG - Intronic
1188627895 X:32310053-32310075 AAATACGAATGAAAGTGCTTTGG + Intronic
1188946278 X:36306898-36306920 AAAATTTAATTAACTTGGTTTGG - Intronic
1189016146 X:37098109-37098131 AAAAAAGACTTAACTGGCATTGG - Intergenic
1189453576 X:41162856-41162878 AAGAACGGCTTAACTTCCTTAGG + Exonic
1189570835 X:42294860-42294882 AAAAAAGAATTTAATTGCTGAGG - Intergenic
1191580401 X:62754788-62754810 AAAAATGAATGTACTTGTTTGGG - Intergenic
1192989523 X:76433908-76433930 AACAACCAAGAAACTTGCTTAGG - Intergenic
1194688419 X:96953156-96953178 AAAAGCTAATTAAATTTCTTGGG - Intronic
1195158794 X:102151200-102151222 ATAAACAAATTAACCTGCTTAGG + Intergenic
1196236570 X:113288137-113288159 AAAACCTAATTAACTTGGCTAGG + Intergenic
1198782493 X:140252567-140252589 CAAACCAAATTACCTTGCTTAGG - Intergenic
1198950847 X:142070439-142070461 ATCAATGAATTATCTTGCTTTGG - Intergenic
1201326922 Y:12771134-12771156 AAGAACGACTAAACTTCCTTAGG + Exonic