ID: 1041031331

View in Genome Browser
Species Human (GRCh38)
Location 8:53738441-53738463
Sequence CTACCTCTCCTTACTAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041031330_1041031331 2 Left 1041031330 8:53738416-53738438 CCAAAGCAAGTTAATTCGTTTTT 0: 1
1: 0
2: 1
3: 17
4: 334
Right 1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG No data
1041031329_1041031331 30 Left 1041031329 8:53738388-53738410 CCACAGAAGGAAGAGAAAGCAAT 0: 1
1: 1
2: 4
3: 53
4: 520
Right 1041031331 8:53738441-53738463 CTACCTCTCCTTACTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041031331 Original CRISPR CTACCTCTCCTTACTAGACC AGG Intronic
No off target data available for this crispr