ID: 1041035917

View in Genome Browser
Species Human (GRCh38)
Location 8:53790419-53790441
Sequence CTGTATAAAGGGCTGGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041035917_1041035924 6 Left 1041035917 8:53790419-53790441 CCCACGACCAGCCCTTTATACAG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1041035924 8:53790448-53790470 ATATTTACTGAGGGTCCATTAGG No data
1041035917_1041035925 15 Left 1041035917 8:53790419-53790441 CCCACGACCAGCCCTTTATACAG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1041035925 8:53790457-53790479 GAGGGTCCATTAGGCACCAAAGG No data
1041035917_1041035922 -4 Left 1041035917 8:53790419-53790441 CCCACGACCAGCCCTTTATACAG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1041035922 8:53790438-53790460 ACAGTCACAAATATTTACTGAGG No data
1041035917_1041035923 -3 Left 1041035917 8:53790419-53790441 CCCACGACCAGCCCTTTATACAG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1041035923 8:53790439-53790461 CAGTCACAAATATTTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041035917 Original CRISPR CTGTATAAAGGGCTGGTCGT GGG (reversed) Intronic
913534667 1:119759719-119759741 CTCTAAAAAGGGCTGGTCTATGG - Intronic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915249844 1:154580138-154580160 CTTTGTAAAGGGCTGGGCGGAGG + Intergenic
920162273 1:204008310-204008332 TTGTATATGGAGCTGGTCGTTGG - Intergenic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
921924718 1:220702014-220702036 CTCTCTAAAGGGCTGCTCCTCGG - Intergenic
1064635037 10:17356809-17356831 CTGTATAGATGGCTGGTCCATGG - Intronic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1083364467 11:62133180-62133202 TTGTGTCAAGGGCTGCTCGTGGG - Intronic
1084437760 11:69154335-69154357 CTGTACTGAGGGCTGGTCCTGGG + Intergenic
1088868884 11:113875172-113875194 AAATATAAAGGGCTGGACGTGGG - Intronic
1089692587 11:120196109-120196131 CTGTGCAAAGAGCTGGTCGGGGG - Intergenic
1096418602 12:51435869-51435891 CTGGAGAAATGGCTGGTCATAGG - Intronic
1100664396 12:96735512-96735534 CTGTAAAAATGACTGGTGGTGGG + Intronic
1107732501 13:43362557-43362579 CTGTACAAAGGGGTTGTCGGGGG - Intronic
1109708319 13:66129418-66129440 CAGTATAAACAGCTGGTCATTGG + Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1119502799 14:75145006-75145028 CTGAAGAAAGGGCTGGTCTTCGG + Intronic
1122129783 14:99598364-99598386 CTGTATCACGTGCTGGTCCTGGG + Intronic
1122815478 14:104310059-104310081 CTGTAGAGAAGGCTGGACGTGGG + Intergenic
1126687747 15:51263257-51263279 CTGTATAAAGGGCTGCTGAGTGG + Intronic
1129324242 15:74791591-74791613 CTATATCAAGGGGTGGTCGGGGG - Intronic
1138831353 16:60378915-60378937 CTATAGAAAGGGCTGGGCTTTGG + Intergenic
1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG + Intronic
1140870368 16:79100968-79100990 CTGTAGAAAGGTCTTGTGGTGGG + Intronic
1145213554 17:21034586-21034608 CTGGACAAAGGGATGGTCATGGG - Intronic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1156296691 18:35798140-35798162 CTGCTTAAAGGGCTGATTGTTGG - Intergenic
1167563195 19:50238894-50238916 TTGTATAAAGGAATGTTCGTAGG - Intronic
926792290 2:16586159-16586181 GTGTATAAAGGCCTGGGAGTAGG - Intronic
929164595 2:38868524-38868546 ATGTAAAAAGAGCTGGTCTTGGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
939690516 2:145254519-145254541 CTGTGTAAAGGGCTGCGAGTTGG - Intergenic
942741111 2:179179206-179179228 CTTTATAAAGGGCCTGTTGTAGG + Intronic
943743218 2:191433693-191433715 CTGTTTAAGGGGCTGATCTTCGG + Intergenic
948569806 2:238910832-238910854 CTGTATCAAGAGCGGGGCGTGGG - Intergenic
1181157612 22:20933883-20933905 CTTTTTAAAGGGCAGGTCTTCGG - Exonic
1184217714 22:43078730-43078752 CTGTATAAAGGACTGCTGTTAGG + Intronic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
953667819 3:44938654-44938676 CTGGAGGAAGGGCTGGGCGTTGG + Intronic
962061135 3:131928938-131928960 CTGTAGAGAGGGCTAGTCCTAGG + Intronic
964624317 3:158744696-158744718 CTGTGTAAAGTGCTGGGTGTGGG + Intronic
967687234 3:192431989-192432011 CTGGATAAAGGGCTGCCAGTGGG - Intronic
979964483 4:127061534-127061556 CTCTCTAAAGGGCTGCTCCTGGG + Intergenic
984652447 4:182285099-182285121 CAGTATTAAGGGTTGGTCTTGGG + Intronic
994378801 5:99045381-99045403 ATGCATAAAGGGTTAGTCGTAGG + Intergenic
998947815 5:147359973-147359995 CTGTATAAAGTGCTGGCTCTGGG - Intronic
1005918189 6:30373019-30373041 CTCTCTAAAGGGCTGTTCTTGGG - Intergenic
1017551001 6:155507411-155507433 ATGTATATATGGCTGGGCGTGGG + Intergenic
1021451478 7:20786492-20786514 CTGTAAAATGGGCTGGACGCAGG + Intronic
1023597853 7:41851657-41851679 GTGAATAAAGGGTTGGTTGTAGG - Intergenic
1039429097 8:37511722-37511744 CTGTATGATGGGCTGGGGGTGGG + Intergenic
1041035917 8:53790419-53790441 CTGTATAAAGGGCTGGTCGTGGG - Intronic
1042420236 8:68580023-68580045 CTTTATAAAAGGCTGCTCATAGG + Intronic
1047609148 8:126504023-126504045 CTCTCTAAAGGGCTGCTCCTGGG - Intergenic
1051862008 9:21636552-21636574 TTGTATAAATGGCTGGTTCTAGG + Intergenic
1052572410 9:30243105-30243127 CTGTATAAAGGGAAGGTTATAGG + Intergenic
1057833003 9:98420799-98420821 CTGTGTAAAGGCCTGGAGGTGGG + Intronic
1057851527 9:98570382-98570404 AGGGATAAAGGGCTGCTCGTAGG - Intronic
1188513426 X:30960327-30960349 CTGATTAAAGGGCTGGAAGTAGG + Intronic
1198495056 X:137183950-137183972 GTGTATAGAGGGGTGGTGGTGGG - Intergenic