ID: 1041036790

View in Genome Browser
Species Human (GRCh38)
Location 8:53799800-53799822
Sequence CTCAGATGGCAGAGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 0, 2: 15, 3: 137, 4: 799}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041036790_1041036799 18 Left 1041036790 8:53799800-53799822 CCCTGTCCCCTCTGCCATCTGAG 0: 1
1: 0
2: 15
3: 137
4: 799
Right 1041036799 8:53799841-53799863 CCATTTATGAATGAGGAAACAGG No data
1041036790_1041036797 11 Left 1041036790 8:53799800-53799822 CCCTGTCCCCTCTGCCATCTGAG 0: 1
1: 0
2: 15
3: 137
4: 799
Right 1041036797 8:53799834-53799856 AAGATGGCCATTTATGAATGAGG No data
1041036790_1041036796 -5 Left 1041036790 8:53799800-53799822 CCCTGTCCCCTCTGCCATCTGAG 0: 1
1: 0
2: 15
3: 137
4: 799
Right 1041036796 8:53799818-53799840 CTGAGTTTACAGTGAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041036790 Original CRISPR CTCAGATGGCAGAGGGGACA GGG (reversed) Intronic
900639342 1:3681372-3681394 CACAGCTGGGGGAGGGGACAGGG - Intronic
901453735 1:9351856-9351878 CTCAGATGGCAGAAGTGGCCGGG + Intronic
901473285 1:9472445-9472467 CTCACCTGGCGGGGGGGACAGGG - Intergenic
901624459 1:10616141-10616163 CTCAGGGGGCAGAGACGACAGGG - Intronic
901921017 1:12537789-12537811 CTCAGCTGGCACAGGAGGCAAGG - Intergenic
902689985 1:18105037-18105059 CACAGTTAGCAGAGGGCACAGGG - Intergenic
903221291 1:21870964-21870986 CCCAGAAGGGAGAGGGGAGAAGG + Intronic
904824497 1:33265619-33265641 GGCAGAGGGCAGAGGGGCCATGG + Intronic
904866747 1:33585352-33585374 CTCTGAAGGCAGAGGTGAGATGG - Intronic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
905997214 1:42391619-42391641 TTCAGAGGGCAGAGTGGAGATGG + Intronic
906058887 1:42935712-42935734 CCCAGAGGGCAGAGGTGCCAGGG + Intronic
906173670 1:43749854-43749876 CTCATATGGCAGAAGGCAGAAGG - Intronic
906209789 1:44006247-44006269 CTCAGAGGGGAGAGAGGGCAGGG - Intronic
906259336 1:44374669-44374691 CTCAGATGGTAGAAGAGGCAAGG - Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
909020442 1:70425449-70425471 CTCACATGGTAGAAGAGACAAGG + Intronic
909052416 1:70782630-70782652 CTCACATGGTGGAAGGGACAAGG - Intergenic
909070402 1:70986502-70986524 CTGAGATGACAGTGGGGTCAAGG + Intronic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
911216860 1:95204074-95204096 CTCACAGGGCAGAGGGGTCAGGG - Intronic
912164895 1:107031275-107031297 CTCGCATGGCAGAAGGGGCAAGG - Intergenic
912235404 1:107844985-107845007 CTCAGGAGGCACAGGGGTCAGGG - Intronic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912547525 1:110461633-110461655 CTCATATGGCAGAAGGTAGAAGG + Intergenic
912909935 1:113748083-113748105 CTCAGACGGCTGAGGTGAAAGGG - Intronic
914450248 1:147785310-147785332 CTCAGCTCTCAGAGGGGTCAGGG - Intergenic
915641034 1:157226500-157226522 GTGAGATGCCACAGGGGACAAGG - Intergenic
915841915 1:159220201-159220223 CTCATGTGGCAGAAGGGACAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
915896233 1:159813431-159813453 CTTAGAGGGCAGGTGGGACAGGG - Intronic
915904945 1:159870948-159870970 CTCGGATGGGAGAGAAGACATGG - Intronic
916585545 1:166146691-166146713 TTCAGAAGGCAGAGGGGAAGTGG + Intronic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917587491 1:176442516-176442538 CTCAGATGGCAGAGAGGTGGAGG + Intergenic
918666681 1:187159820-187159842 CTAAAATGGCAAAGGGGACTTGG + Intergenic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
919588490 1:199469469-199469491 CTCACATGACAGAGGGCAAATGG + Intergenic
919645635 1:200091776-200091798 CTAAGATGGCAAAGGGGGCCAGG - Intronic
919826113 1:201504712-201504734 CTGAGATGGTGGTGGGGACAGGG + Intronic
920593342 1:207243867-207243889 GACAGAGGGCAGAGGGGAGAAGG - Intergenic
920831790 1:209472133-209472155 CTCACATGGTAGAGGGAATAAGG + Intergenic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921821601 1:219623131-219623153 CTCACATGGTGGAAGGGACAAGG - Intergenic
921952220 1:220942234-220942256 ACTAGATGGCGGAGGGGACAAGG - Intergenic
921969131 1:221126002-221126024 CTCACATGGCAGAGGGCTGAAGG - Intergenic
922098256 1:222460836-222460858 CTCAGAGGGAAGAGAGGACTGGG + Intergenic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
922727537 1:227929840-227929862 CTCACATGGCAGAAGAGGCAAGG - Intronic
922821549 1:228488400-228488422 GAAAGATGGGAGAGGGGACAGGG - Intronic
923133412 1:231096766-231096788 CAGAGGTGGCTGAGGGGACAGGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924467509 1:244311934-244311956 CTCAGACGGCAGAGCTGAAAGGG - Intergenic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924498813 1:244616547-244616569 ATCAGATGGCAGAAGGCAAAAGG + Intronic
924609051 1:245558655-245558677 CTCAGAAGGTTGCGGGGACAGGG + Intronic
1063231810 10:4072695-4072717 TTCAAATGGCACAGGGGAAATGG - Intergenic
1063630990 10:7733625-7733647 CTGAGAAGTCAGAGGGGCCATGG - Intronic
1063662150 10:8042347-8042369 CTAACATGCCTGAGGGGACAGGG - Intergenic
1063924305 10:10962307-10962329 CACAGAAAGCAGAGGAGACAGGG - Intergenic
1064874520 10:19977726-19977748 CTCACATGGCAGAGGGGGTGGGG + Intronic
1065154302 10:22853668-22853690 CTCTGATGGCAGAGGGGAAGGGG + Intergenic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1065690123 10:28324212-28324234 CTCACGTGGCAGAGGGGCCAGGG - Intronic
1066022558 10:31318785-31318807 CTCCGAGGGCACAGGGTACAGGG + Intronic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066444342 10:35468193-35468215 CTCACATGGCAAAAGGGGCAAGG + Intronic
1066458275 10:35590741-35590763 CTCACATGGCAGAAGAGGCAGGG + Intergenic
1066687485 10:37994504-37994526 CACAGATGGGAGTGGGGCCAGGG + Intergenic
1067050203 10:43011582-43011604 CTCACATGGTGGAAGGGACAGGG - Intergenic
1067450986 10:46381696-46381718 CCCAGGTGGCAGAAGGGACGAGG - Intronic
1067586257 10:47478055-47478077 CCCAGGTGGCAGAAGGGACGAGG + Intronic
1067846449 10:49725920-49725942 CTCACATGGCAGATGGGATGAGG - Intergenic
1067977529 10:51042882-51042904 TTCACGTGGCAGAAGGGACAAGG - Intronic
1068566231 10:58578782-58578804 CACAGGTGGGAGAGGGGGCATGG - Intronic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068804082 10:61174972-61174994 CTCAGATGACAGAAGGCAGAAGG + Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1070256322 10:74815742-74815764 CTCACATGGCAGACGGCAGAAGG + Intergenic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1070818249 10:79338920-79338942 CACAGAAGGCTGAGGGGACCAGG - Intergenic
1071067714 10:81656290-81656312 CCCAGATGCCAGAGGAGCCAGGG - Intergenic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1071599220 10:86948846-86948868 CTCAGATGGCTGAGGTGGAAGGG + Intronic
1072066875 10:91879915-91879937 CTCAGTGGGCAGGGGGGGCATGG - Intergenic
1072209873 10:93236613-93236635 CTCAGAAGCCAGGGGAGACAGGG - Intergenic
1072642370 10:97221605-97221627 CTCACATGGTGGAAGGGACAAGG - Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073248785 10:102109197-102109219 CTCAGATGGGAGAGGGCCCCAGG + Intronic
1074111709 10:110427342-110427364 CCCCCATGGGAGAGGGGACAAGG - Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074244993 10:111680763-111680785 CTCATATGGCAGAAGGCAGAAGG - Intergenic
1074432066 10:113402772-113402794 CTCAGACGGCAGAGGGAGGAAGG + Intergenic
1074489561 10:113927027-113927049 CTCACATGGCAGAAGGGGCTAGG - Intergenic
1074678310 10:115878063-115878085 CTGAGAGGGCAGTGGGGAGAAGG - Intronic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075872390 10:125780244-125780266 CTCATATGGCAGACGGGCAAAGG - Intergenic
1076072786 10:127504874-127504896 AGAAGATGGCAGTGGGGACAGGG + Intergenic
1076547526 10:131255184-131255206 CCCCACTGGCAGAGGGGACAAGG + Intronic
1076617811 10:131768446-131768468 CCCAGTAGGCAGTGGGGACATGG - Intergenic
1076841239 10:133046708-133046730 CTCAGCTGGGAGATGGGACAGGG - Intergenic
1077068824 11:657900-657922 CACAGGTGGCAGCGGGGACAAGG + Intronic
1077158955 11:1103978-1104000 ATGAGCTGGCAGAGGGGAGATGG - Intergenic
1077278610 11:1730616-1730638 CTCAGATGGATGGGGGCACAAGG - Intergenic
1077493268 11:2871852-2871874 CTGAGGTGGCAGAGTGAACAGGG - Intergenic
1077549472 11:3193650-3193672 CTCAGAGGGGACAGGGGTCAAGG + Intergenic
1077578524 11:3402459-3402481 CTCAGATGGCAGGGGTGGCCTGG + Intergenic
1077861336 11:6183558-6183580 ATCATATGGCAGAAGGGATAAGG + Intergenic
1077956618 11:7027407-7027429 CTCACATGGCAGAAGGAACCAGG + Intronic
1078087120 11:8240632-8240654 CTCACGTGGCAGAAGGGGCAAGG + Intronic
1079075224 11:17381322-17381344 GACAGATGGCAGAGATGACAAGG + Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1079738497 11:24028228-24028250 TTCACATGGTAGAAGGGACAAGG + Intergenic
1079969163 11:27015459-27015481 CTCATGTGGCAGAAGGGACAGGG + Intergenic
1080024157 11:27596269-27596291 CTCATGTGGCAGAAGGAACAAGG - Intergenic
1080294093 11:30705281-30705303 CTCACATGGTGGAAGGGACAAGG + Intergenic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080422689 11:32125757-32125779 CTCAGAGGGCAAAAGGGGCAAGG - Intergenic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1081660979 11:44888224-44888246 CTCAGATGCCAGAAGGCACATGG - Intronic
1081866759 11:46364513-46364535 CTCAGATGACAGGGAGGTCAGGG - Intronic
1081872283 11:46388765-46388787 CTCACGTGGAGGAGGGGACAGGG + Intergenic
1082874775 11:57977318-57977340 CTCACATGGTGGAAGGGACAAGG - Intergenic
1082998171 11:59268984-59269006 CTCACATGGCAGAAGAGGCAAGG + Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1083211511 11:61190242-61190264 CTCAGGTGGCTGAGGTGAGAGGG + Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084274993 11:68046799-68046821 CACAGAAGCCAGAGAGGACAGGG - Intronic
1084288785 11:68148459-68148481 CTCAAAAGGCACAGGGGATATGG - Intergenic
1085398544 11:76220268-76220290 CTCACATGGCAGAGAATACAGGG - Intergenic
1085845861 11:80064048-80064070 CTTAGGTGGCAAATGGGACATGG - Intergenic
1085846454 11:80071388-80071410 TTCACATGGCAGAAGGGGCAAGG - Intergenic
1086125886 11:83348054-83348076 GTCAGATGGCAGAAGGGTCAAGG - Intergenic
1087218032 11:95515834-95515856 CTAAGATAGGAGAGGGGAAAGGG - Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1088062240 11:105668997-105669019 CGCAAATGGCAGAGGGGTGAGGG - Intronic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088896645 11:114083570-114083592 CTAAGAGGGCAGAGGGGAGAGGG - Intronic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089469104 11:118706585-118706607 CTCAGAGGGCAGGGTGGAGATGG + Intergenic
1089698900 11:120232342-120232364 CTCTGGTGGATGAGGGGACAAGG + Intergenic
1090029626 11:123195720-123195742 CGCAGAGGACAGAGGGGAGAGGG - Intergenic
1090374476 11:126279287-126279309 CTCACATGGCAGAAGGGGTAAGG + Intergenic
1090473375 11:126999540-126999562 CTCAGATGGCAGAGGTGCATTGG + Intronic
1090601696 11:128379045-128379067 CTCACATGGCAGAGAGGAAGAGG + Intergenic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091240191 11:134046928-134046950 CTCACCTGGCTGAGGGGACGAGG - Intergenic
1092168082 12:6355214-6355236 CTCAGATTGCAGAGGGGCAGCGG - Intronic
1092286853 12:7133555-7133577 CTCACCTGGCAAAGGGGAGAAGG - Exonic
1092601058 12:10065173-10065195 TTCAGATGGCAGTGGGGAGATGG + Intronic
1092879557 12:12877505-12877527 CTCAGAGGACAGAGGAGATATGG + Intergenic
1092954901 12:13540906-13540928 GTCACATGGCAGAGGGGAAATGG - Exonic
1093214125 12:16343259-16343281 CTCACATGACGGAGGGGGCAGGG - Intergenic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093480562 12:19600177-19600199 CTCAGGTGGCAGAAGGAGCAAGG - Intronic
1093480844 12:19602383-19602405 CTCATATGGCAGAGGGGGCATGG - Intronic
1093773123 12:23040160-23040182 CTAAGAGGGCAGAGGTGATAAGG + Intergenic
1095248766 12:39954317-39954339 TTCAGATGGCAGAGGACCCAGGG + Intronic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1096113168 12:49040759-49040781 CTGAGATGCCCGAGGGGTCAGGG + Exonic
1096263690 12:50107929-50107951 CTCAGATGGGAGTGGGGTCTTGG - Intronic
1098633548 12:72754086-72754108 CTCAGAAGGCCGAGGGGAGGTGG - Intergenic
1098842486 12:75493291-75493313 CTCAGAGGGCAGAGGGCAAAGGG - Exonic
1098958676 12:76715122-76715144 CACTGAAGGCAGAGGAGACAAGG + Intergenic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1099449700 12:82794159-82794181 CTCAGCTGGCATGTGGGACAGGG + Intronic
1100206054 12:92350950-92350972 TTCACATGGCAGGAGGGACAAGG - Intergenic
1100288081 12:93186816-93186838 CTCACATGGTGGAAGGGACAAGG - Intergenic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102138054 12:110591748-110591770 CTCAGCAGGCAGGCGGGACAGGG + Intergenic
1102386321 12:112513583-112513605 CTCACATGGCAGCTGAGACAAGG - Intergenic
1103769607 12:123311283-123311305 CACAGATGACAGAGTGAACAAGG - Intronic
1104605471 12:130184517-130184539 CTAAGATGGGAGAGTGGACGGGG - Intergenic
1104748015 12:131221927-131221949 GGCAGAGGGCAGAGGGGTCAGGG + Intergenic
1105247777 13:18667977-18667999 CTGAGATGGCTGAGGCCACAGGG + Intergenic
1105303367 13:19153803-19153825 GCCAGAAGGGAGAGGGGACAGGG + Intergenic
1105944406 13:25177234-25177256 GTCAGATAGCAGAGGGTGCATGG + Intergenic
1106013532 13:25847085-25847107 CCCAGATGGCAGAGGCCACATGG - Intronic
1106158868 13:27183099-27183121 CACAGATGGAAAAGGAGACAAGG - Intergenic
1106524807 13:30530937-30530959 CTCAGAAGGCTGAGGTGAGAAGG + Intronic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1107371360 13:39753248-39753270 GTCACATGGTAGAAGGGACAGGG - Intronic
1107414044 13:40184628-40184650 CTCACATGGCAGAAGGGATGAGG + Intergenic
1107557666 13:41531898-41531920 CTCACATGGCAGAAGAGAAAAGG + Intergenic
1108238925 13:48441218-48441240 CTCAGATGGTGGAAGGGACAAGG + Intronic
1108281457 13:48866287-48866309 CTCACATGGTTGAGGGGGCAAGG - Intergenic
1108447800 13:50526847-50526869 CTGAGAGGGGAGAGGGGAGAGGG + Intronic
1108464063 13:50696663-50696685 CTCAGATGTGAGAGGAGACCTGG + Intronic
1109120523 13:58450146-58450168 CTCACTTGGCACAAGGGACAAGG - Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109413503 13:62005652-62005674 CTCACATGGCAGAAGGCAAAAGG - Intergenic
1109685348 13:65812732-65812754 CTCAGTTGGTAGAGGGGAGTTGG + Intergenic
1110002277 13:70218370-70218392 CTTAGATGGTAGAGAGGACTTGG - Intergenic
1110159335 13:72357071-72357093 CTCACATGGCAGAGGACAGAAGG + Intergenic
1110184838 13:72660884-72660906 CTCAGAGAGCAGAGGAGACTTGG - Intergenic
1110323751 13:74189517-74189539 CACAGTTAGCAGAGGGAACAAGG - Intergenic
1110405205 13:75143332-75143354 CTTAGTTGGGAGAGGGGAAAGGG + Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1112263728 13:97902930-97902952 CTCATATGGCAGAAGGTGCAGGG - Intergenic
1112283439 13:98082827-98082849 CTCATATGGTAGAAGGGACAAGG - Intergenic
1112376332 13:98845152-98845174 ATCAGTCAGCAGAGGGGACAAGG - Intronic
1112805343 13:103158769-103158791 CTAAGATGGGAAAGGGGAAATGG + Intergenic
1113592930 13:111513279-111513301 CTCTGAGGGCAGAAGGGACTTGG + Intergenic
1114007863 14:18333267-18333289 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1115268846 14:31528911-31528933 TTCAGGAGGCTGAGGGGACAGGG - Intronic
1116667935 14:47801451-47801473 CTCACGTGGCCGAAGGGACAAGG - Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117305195 14:54467248-54467270 TTCATGTGGCAGAGGGTACAAGG - Intergenic
1117733078 14:58743474-58743496 CTCACATGGCAGAAGGCTCAAGG - Intergenic
1118049943 14:62015689-62015711 CTCACATGGTAGAGGAGGCAAGG - Intronic
1118266017 14:64295245-64295267 CTCAGGTGGCATAAGGGACATGG + Intronic
1118839922 14:69502412-69502434 CTAAGCAGGCAGAGGGGAGAGGG - Intronic
1118878446 14:69805016-69805038 CTTAGATGGTGGAGGGGGCAAGG - Intergenic
1119218852 14:72890809-72890831 ATCAGATCACAAAGGGGACACGG - Intronic
1119540615 14:75435754-75435776 TTCTGATGGCCCAGGGGACACGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1119668043 14:76498829-76498851 CACAGATGGGGGAGGGGGCAAGG - Intronic
1119754475 14:77105320-77105342 ACCAGAGGGGAGAGGGGACAGGG - Intronic
1120210561 14:81629688-81629710 CTCAGAGGTCTCAGGGGACATGG - Intergenic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1120901410 14:89578953-89578975 CTCAGGTGGCTGAGGTGAGAGGG - Intronic
1121156233 14:91687446-91687468 CTCACGTGGCAGAGGGGCAAGGG - Intronic
1121248534 14:92482675-92482697 TGCAGAGGCCAGAGGGGACAAGG + Exonic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1121702064 14:95962110-95962132 CTTAGACAGCAGGGGGGACATGG - Intergenic
1121906431 14:97750428-97750450 CTCAGAAGGCAGAGGTTTCAAGG + Exonic
1121917743 14:97851598-97851620 CTCAGCTGGCAGATGGGAGAGGG - Intergenic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1122047984 14:99036868-99036890 CTGAGATGGCAGCGGTGACAGGG - Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122318442 14:100839359-100839381 CTCCTTTGGAAGAGGGGACAGGG - Intergenic
1122329328 14:100902223-100902245 ATCGGAGGGCAGAGGGGGCAAGG - Intergenic
1122409643 14:101519254-101519276 CTCAGATGCCATGGGGGAGATGG - Intergenic
1122420147 14:101571363-101571385 TTAGGATGGCAGTGGGGACAGGG - Intergenic
1123711052 15:22987941-22987963 TTCACATGGCAGAAAGGACAAGG - Intronic
1124047396 15:26162867-26162889 CTCACATGGCCGAAGGGGCAAGG + Intergenic
1124140282 15:27071306-27071328 CTCAGAGGGAAGAGAGGAGAAGG - Intronic
1124385625 15:29206227-29206249 CTCACCTGGCAGAAGAGACAAGG + Intronic
1124625890 15:31307319-31307341 CTCAGAAGGGAAAGGGGAAAGGG - Intergenic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1124983751 15:34585256-34585278 CACAGAGGGCAGAGTGGAAATGG + Intronic
1125006463 15:34822976-34822998 CGCACATGGCGGAGGGGACTGGG - Intergenic
1125541922 15:40474622-40474644 CTCAGAGGCCTGTGGGGACAAGG + Intergenic
1126107927 15:45159117-45159139 TTCAGGAGGCAGAGGGGACAGGG + Intronic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126688015 15:51265249-51265271 CTCAGAGGGAAGGGAGGACATGG - Intronic
1127542316 15:59952901-59952923 CTCAAATGGTAGAAGGGACCAGG + Intergenic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1128407132 15:67353993-67354015 CTAATATGCCAGAGGGGAGAAGG + Intronic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128852456 15:70973443-70973465 ATCAGAAGGCAGGGGGGTCAGGG + Intronic
1128883743 15:71266138-71266160 GTCAGAAGGCACAGGGGTCAGGG - Intronic
1128983018 15:72199938-72199960 CTCAGATGGCAGGGTTGGCAGGG + Intronic
1129231290 15:74198570-74198592 CTCAGATGGCAGTGAGTAGAGGG - Intronic
1129237125 15:74230303-74230325 CTCAGAGGGCAGAGAGGCCTTGG - Intergenic
1129429229 15:75486393-75486415 CTCACATGGCAGAAGGGGAAGGG - Intronic
1130031483 15:80318252-80318274 CTCAGGTGGTAGAAGGGGCATGG + Intergenic
1130043595 15:80426907-80426929 CTCACGTGGCAGAGGGAGCAGGG + Intronic
1130429610 15:83833356-83833378 CTCACATGGCAGAAGGGATGAGG + Intronic
1130985445 15:88841928-88841950 CTCAGGTGTCAGTGGGGAGATGG - Intronic
1131074754 15:89488083-89488105 CTCAGATGTCACAGGACACAGGG + Intronic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1131980452 15:97989502-97989524 CTCAGATGGCAAGGGGCTCAAGG + Intergenic
1132338871 15:101065663-101065685 CTCTGAGGGCAGAGGGGAGGAGG + Exonic
1132524190 16:406210-406232 CCCAGCTGGCAGAGGGCACAGGG - Intronic
1132595674 16:748216-748238 CCCGGGTGGCAGAGGGAACATGG + Intronic
1132646980 16:1003661-1003683 CTCTGATGGCAGCCTGGACACGG + Intergenic
1132857340 16:2052550-2052572 TTCGGGTGGCAGAGGGGAGAGGG - Intronic
1132933574 16:2470474-2470496 CCCAGCTGGCAGGGAGGACATGG - Intergenic
1133119834 16:3599216-3599238 CTGAGATGGCAGAGGGCAGAGGG - Intronic
1133347130 16:5078608-5078630 CTCAGATGGCAGGGGTGGCCTGG + Intronic
1134310226 16:13069841-13069863 CTCACAGGGCAGAAGGGCCAAGG - Intronic
1135221937 16:20621478-20621500 CTGAGATGCCAGAGAGGCCAGGG - Intronic
1136247979 16:28986006-28986028 CTGAGCTGGGAGAGGGGAGATGG + Intronic
1136476491 16:30516955-30516977 CTCACCTGGCACAGAGGACAAGG - Exonic
1137002623 16:35243094-35243116 TGCACATGGCAGAAGGGACAAGG - Intergenic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137863850 16:51873442-51873464 TTCACATGGCACAAGGGACAAGG - Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1138456189 16:57122117-57122139 CGCTGATGCCAGAGAGGACAGGG - Intronic
1138658954 16:58506787-58506809 CTCAGCAGGCAGGGGAGACAGGG - Intronic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1140246072 16:73250966-73250988 CTCAGATTGCAGATGAGACCAGG - Intergenic
1140514530 16:75532473-75532495 CTCAGTGGGCAGTGTGGACAGGG - Intronic
1140706871 16:77638965-77638987 CTCACATGGCAGAAGGGGCCAGG - Intergenic
1140878252 16:79173292-79173314 CTAAGATGGCACATGGCACATGG - Intronic
1140879860 16:79188177-79188199 CAGAGATGGGAGAAGGGACAAGG + Intronic
1140913008 16:79470375-79470397 CTCAGAGGGCCCAGGGGACCAGG + Intergenic
1141064932 16:80906772-80906794 CTCAGAAGGCTGAGGTGAGAGGG - Intergenic
1141457649 16:84154518-84154540 CTCCCAGGGCAGAGGGGTCACGG - Intronic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1142087861 16:88193857-88193879 CTCACATGGCGGAAGGGGCAAGG + Intergenic
1142428200 16:90011781-90011803 CCCAGAGGGCACAGGGGACAGGG + Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1142804940 17:2366525-2366547 CTCAGAGGGCACACGGCACAGGG + Intronic
1143465086 17:7131182-7131204 AACAGATGGCAGAGAGGCCAGGG - Intergenic
1143917050 17:10301812-10301834 CCCTGATGGCAGAGAGGGCAGGG + Intronic
1144125927 17:12202829-12202851 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146887489 17:36482475-36482497 CTTAGATACCAGAGGGGAAACGG + Intergenic
1147118883 17:38323486-38323508 CTCAGATGGCCTAGGACACATGG - Intergenic
1147252950 17:39164732-39164754 GTTAACTGGCAGAGGGGACAGGG + Intronic
1148146204 17:45366681-45366703 CTCAGCAGGCAGAGGGGAGAGGG - Intergenic
1148571055 17:48669464-48669486 CTCACATGGCAGATGGGTGAGGG - Intergenic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149659150 17:58325370-58325392 CCCAGGTGGGAGAGGGGAGAAGG - Intronic
1149895032 17:60422532-60422554 GTCAGAAGCCAGAGGGGACGTGG + Exonic
1150309282 17:64114546-64114568 CAGAGAAGGCAGAGGGGATATGG + Intronic
1150551385 17:66213828-66213850 CTCAGAAGGCTGAGGTGAAAGGG + Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150884677 17:69071271-69071293 GTCAGAAGGCACAGGGGTCAGGG - Intergenic
1150907971 17:69358909-69358931 CTCACATGACAGAGGGGGGAAGG - Intergenic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1151145453 17:72036337-72036359 CTCACATGGCATAAGGGAAAAGG + Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1151814765 17:76466347-76466369 CTCAGAGTGCAGAGGGGCCCTGG + Intronic
1151860408 17:76756895-76756917 CACAGAGGCCAGAGGGGAAAAGG + Intronic
1151985448 17:77540458-77540480 AGCTGATGGCAGTGGGGACAGGG - Intergenic
1152015575 17:77748413-77748435 TTCAGAGGGCAAAGGGAACATGG + Intergenic
1152145486 17:78566035-78566057 CTTACATGGCAGAAGGGGCAAGG - Intronic
1153097288 18:1421507-1421529 CTCACATGGCAGAAGAGAGAAGG + Intergenic
1153100911 18:1468592-1468614 CTCACATGGTGGAAGGGACAAGG - Intergenic
1153746414 18:8184433-8184455 CTCTGAAGGCACAGAGGACAGGG - Intronic
1153945722 18:10015631-10015653 CTCAGAGGGCAGCAGAGACATGG - Intergenic
1154441067 18:14391142-14391164 CTGAGATGGCTGAGGCCACAGGG - Intergenic
1155359971 18:24990160-24990182 CTCATATGGCAGGAGGGACTTGG - Intergenic
1156181598 18:34611846-34611868 CTCCGCTGGCAGAGGGGTCTCGG + Intronic
1156495123 18:37520496-37520518 CTCAGCTGGCAGAGGGTAACAGG + Intronic
1156700474 18:39818944-39818966 ATCAGATGGCAGAGTGAAAAAGG - Intergenic
1156905585 18:42348528-42348550 CTCAGTTGGTAGAGGAGAGATGG + Intergenic
1157679707 18:49595137-49595159 CTTACATGGCAGAGGGCTCAGGG - Exonic
1157924633 18:51749850-51749872 CTCCCATGGTAGAAGGGACAAGG + Intergenic
1158341575 18:56472307-56472329 CTCTGATGCCAGAGGAGACACGG - Intergenic
1158727562 18:59987377-59987399 CTCACATGGCAGAAGGGCAAGGG - Intergenic
1158836290 18:61334229-61334251 CTCCGCCTGCAGAGGGGACAGGG + Intronic
1158861690 18:61598657-61598679 CTCTCATGGCAGAGGGGAAGGGG - Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159975057 18:74701090-74701112 CTCACATGGCAGAGAGACCAGGG + Intronic
1160011080 18:75107491-75107513 CTCTCCTGGCAGATGGGACACGG + Intergenic
1160014564 18:75130662-75130684 CTCTGATGGCAGAGGGATCCCGG + Intergenic
1160243107 18:77136921-77136943 CTCAGAGGGAAGAGGCCACATGG + Intergenic
1160391084 18:78533747-78533769 ATCAGACAGGAGAGGGGACAGGG - Intergenic
1160509840 18:79447239-79447261 CTCAGATGTCAGTGGGCAGAGGG - Intronic
1160587906 18:79922873-79922895 ATCAGAGGGCAGAGAGGCCAGGG + Intronic
1160622371 18:80180232-80180254 CCCAGGTGGCAGAGGGGACAAGG + Intronic
1161287136 19:3474454-3474476 CTCAGCTGGCAGTGGGTGCATGG + Exonic
1161530383 19:4785413-4785435 CGCAGATGGCAGAGGGGCTGGGG + Intergenic
1161531897 19:4794611-4794633 CTGAGATGGCCGAGGGCACAGGG + Exonic
1162129548 19:8517617-8517639 GTGAGGTGGCAGAAGGGACAGGG + Intergenic
1162187930 19:8921845-8921867 CCCAGGGGGAAGAGGGGACAGGG - Intronic
1162568796 19:11458769-11458791 CAGATATGGGAGAGGGGACATGG + Intronic
1163132081 19:15280628-15280650 GTAAGATGCCTGAGGGGACATGG + Intronic
1163471644 19:17500694-17500716 GTCACCTGGCAGAGGGGAGAGGG - Exonic
1163894794 19:20049282-20049304 CTCACATGGCAAAAGAGACAAGG + Intergenic
1164464015 19:28472235-28472257 CTAAGCTGGAAGAGTGGACAGGG - Intergenic
1164757951 19:30704309-30704331 CTAAGATGGCACAGGCAACATGG + Intronic
1165473551 19:36016871-36016893 GTCACATAGGAGAGGGGACAGGG + Intronic
1165494810 19:36146242-36146264 CTCAGATGAAAGTGGGAACATGG + Exonic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1165642252 19:37399681-37399703 CTCACATGGCAGAAGGCAAAAGG + Intergenic
1165817807 19:38653102-38653124 ATCAGATGACAGAGGGGAGCGGG + Intronic
1166123309 19:40698973-40698995 CTGAGATGGGACAGGGGAAAAGG - Intronic
1167253507 19:48414188-48414210 CTAAGAGGGAGGAGGGGACAAGG + Intronic
1167353780 19:48991592-48991614 CTCAGGGGGAAGAGGGGACTGGG + Intronic
1167493906 19:49806983-49807005 CACAGAGGGGAGAGGGGCCAGGG + Exonic
1167706436 19:51083956-51083978 GGCCGATGGCAGAGGGGAGACGG + Intronic
1168281737 19:55309571-55309593 TTCACATGGCAGAAGGGGCAAGG + Intronic
924998713 2:386820-386842 GGCAGAGGGCAGAGGGGAGAGGG - Intergenic
924998720 2:386841-386863 GGCAGAGGGCAGAGGGGAGAGGG - Intergenic
924998734 2:386883-386905 GGCAGAGGGCAGAGGGGAGAGGG - Intergenic
924998743 2:386918-386940 CGCAGAGGGCAGAGGGGAGAGGG - Intergenic
925038477 2:710690-710712 CTCACACAGCAGAAGGGACAGGG - Intergenic
925047945 2:788791-788813 CTCTGATGGCAGCCAGGACACGG + Intergenic
925447947 2:3943518-3943540 CTCAGAGGGTAGTGAGGACAAGG - Intergenic
925483361 2:4301409-4301431 CTCACATGGTGGAAGGGACAAGG - Intergenic
925504412 2:4544718-4544740 CTCACATGGCAGAAGAGGCAAGG + Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
926251354 2:11156939-11156961 TTCAGGTGGGAGAGGGGACAAGG + Intronic
926777261 2:16434869-16434891 GTCACAGGGCAGAGGGGACTTGG + Intergenic
927343581 2:22010305-22010327 CACGGATGGCAGAGGGCACGGGG - Intergenic
927427613 2:22998189-22998211 CTGAGATGGCAGAGAGTTCATGG + Intergenic
927519392 2:23689962-23689984 CCCAGAAGGCAGAGGGGGCAAGG - Intronic
928299770 2:30114880-30114902 TTCAGATGGAAGCGGGGAGATGG - Intergenic
928801204 2:35094971-35094993 TTCACATGGCAGAAGGGGCAAGG + Intergenic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929533850 2:42768298-42768320 CTCAGGAGGAGGAGGGGACAAGG + Intronic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930137689 2:47919002-47919024 TACAGAAGGCAGAGTGGACATGG - Intergenic
930151643 2:48066231-48066253 CTCAGATGGTAAAGGGGATAGGG + Intergenic
930572232 2:53101841-53101863 CTCATATGGCAGAAGGCAAAAGG + Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
931443190 2:62305629-62305651 CACAGAGGCCAGACGGGACAGGG + Intergenic
932654770 2:73601071-73601093 CTCAGCTGTCAGAGGCCACAGGG - Intronic
932837675 2:75052250-75052272 CTCAGATGGTGGAAGGGGCAAGG - Intronic
933488224 2:82950036-82950058 GTCAGAAGGCACAGGGGTCAGGG + Intergenic
934489582 2:94751885-94751907 TTAAGGTGGCAGAGGGGAAAGGG - Intergenic
934520892 2:95019583-95019605 CTGAGTTGGCACAGGGGACTTGG - Intergenic
934609808 2:95726711-95726733 CTCACATGGCAGGGGGGTGAGGG + Intergenic
934780084 2:96964461-96964483 CCCAGGTGGCAGAGGAGACGGGG + Intronic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
935049011 2:99508056-99508078 CTCAGATGGATTATGGGACATGG - Intergenic
935123710 2:100203807-100203829 CTCAGAGGGCAGAGGCAAGACGG - Intergenic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935314542 2:101818643-101818665 CTCAGATGGTGGAGTGGGCAGGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935586790 2:104807794-104807816 ACCAACTGGCAGAGGGGACATGG + Intergenic
935608755 2:104998653-104998675 CTCAGAAGGAGGAGGCGACAGGG - Intergenic
936053898 2:109246346-109246368 CTCCCATGGTAGAGGGGGCAAGG + Intronic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936311441 2:111388376-111388398 CTCACATGGTAGAGGGGATGAGG - Intergenic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
937299454 2:120830286-120830308 CTCAGAGGGCAGAGGGAGCTAGG - Intronic
937921071 2:127131296-127131318 CACAGATGGCAGAAGGCAGAAGG - Intergenic
938292095 2:130155776-130155798 GACAGAAGGGAGAGGGGACAGGG + Intronic
938464458 2:131517193-131517215 GACAGAAGGGAGAGGGGACAGGG - Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938745626 2:134275688-134275710 CTCAGAAGGCTGAGGCGGCAGGG - Intronic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
939499370 2:142963499-142963521 CTCACATGGCAGAAGGGCTAAGG + Intronic
939903396 2:147879312-147879334 CTCACAGGGCAGAGGGCAGAAGG + Intronic
939964066 2:148593240-148593262 CACAGAAGGCACAGGGGCCAGGG + Intergenic
940038868 2:149338549-149338571 CTCACATGGCAGAAGAAACAAGG - Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
941829987 2:169945455-169945477 CCCAGATGGCTGAGGGGACTTGG - Intronic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
942717215 2:178906881-178906903 CTGAGATGGCAGCAGGCACAGGG - Intronic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
944467609 2:200018793-200018815 CTCACATGGCAGAAGGGGTAAGG + Intergenic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
944597445 2:201274178-201274200 CTCAGCAGGCAGAGGGGAAAGGG - Intronic
945177779 2:207060908-207060930 TTCAGAAAGCAGAGGTGACAGGG - Intergenic
945319503 2:208405839-208405861 CTCACATGGCAGAAGGGATGAGG - Intronic
945389061 2:209242108-209242130 GTCAGAAGGCACAGGGGTCAGGG - Intergenic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
946443147 2:219713969-219713991 CTCATATGGCAGAAGGGGTAGGG - Intergenic
946447913 2:219755353-219755375 CTCATATGGTAGAAGGGACAAGG - Intergenic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947082580 2:226415217-226415239 CTCATATGGCAGAAGGCAGAAGG - Intergenic
947231280 2:227889370-227889392 TTCACATGGCAGAGGGCAGAAGG + Intronic
947361787 2:229352847-229352869 CTCACATGGTGGAAGGGACAGGG - Intergenic
947827835 2:233118254-233118276 GTACGATGGCCGAGGGGACAGGG - Intronic
948336141 2:237208852-237208874 CTGAGATGGCTAAGGGGACCAGG - Intergenic
948765997 2:240219354-240219376 CTCACATGGCAGAAGGGGTAAGG + Intergenic
948910501 2:241000018-241000040 CACAGATGGCAGAGGCGATGTGG - Intronic
948987856 2:241536336-241536358 CTCAGATCCCAGAGGGAACAGGG + Intergenic
1168975056 20:1958598-1958620 CTTATATGGCAGAGGGCAGAAGG - Intergenic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169353927 20:4892177-4892199 TGCAGCTGGCAGTGGGGACAGGG + Intronic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1170064172 20:12292624-12292646 CTCACATGGTGGAAGGGACAGGG - Intergenic
1170946808 20:20898768-20898790 CTCATATGGTAGAGGGGATGAGG - Intergenic
1171295058 20:24010121-24010143 CTCACATGGCAAAGGGGTGAGGG - Intergenic
1171398737 20:24857909-24857931 CTCAGAGGGCAGAAGATACATGG + Intergenic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1172168791 20:32916213-32916235 CTCACATGGTAGAGAGGACAAGG + Intronic
1172229440 20:33327043-33327065 CTTGGATGGCAGTGGGGCCAGGG - Intergenic
1173190361 20:40871170-40871192 CACAGGTGGCAGGGGAGACAGGG + Intergenic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173589325 20:44211686-44211708 CTCAGATGGTAGGCGGGAAAAGG + Intergenic
1173706038 20:45110982-45111004 CTCAGATGGCACAAATGACAGGG + Intronic
1173823815 20:46034925-46034947 CTGAGAAGGGAGAGGGGTCAGGG - Intronic
1174219363 20:48940770-48940792 TCAAGATGGCAGAGGGGTCAGGG + Intronic
1174339905 20:49889086-49889108 CTGAGATGGCTGAGGGGGCCAGG - Exonic
1174517766 20:51106296-51106318 CTCACATGGCAGAAGGGGAAAGG - Intergenic
1174665760 20:52256368-52256390 CTTAGAGGCCAGAGGGGACTCGG - Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1174821188 20:53727802-53727824 CTCAGATGGGTGAGGGGAGTGGG - Intergenic
1175156111 20:56972761-56972783 CCCAGAAGGCAGAGGGGCCCGGG + Intergenic
1175184376 20:57170111-57170133 GTGAAATTGCAGAGGGGACAAGG - Exonic
1175400423 20:58697028-58697050 CACAGGATGCAGAGGGGACAGGG - Intronic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175720344 20:61281806-61281828 GTCAGATGGCAGACAAGACATGG - Intronic
1176101609 20:63367002-63367024 CTCAGAGGGCTCAGGGGAGAGGG - Intronic
1176109788 20:63406023-63406045 CTCAGATCCCAGAAGGTACAGGG + Intronic
1176454989 21:6900036-6900058 CTGAGATGGCTGAGGCCACAGGG + Intergenic
1176833162 21:13765084-13765106 CTGAGATGGCTGAGGCCACAGGG + Intergenic
1177677171 21:24315911-24315933 CTCTGAGGGCAGAGGACACAAGG + Intergenic
1178169373 21:30021555-30021577 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1178170339 21:30033574-30033596 CCCAGAAGGCTGAGTGGACAGGG - Intergenic
1178810190 21:35874594-35874616 TTCATATGTCAGAGAGGACAAGG - Intronic
1178864378 21:36316133-36316155 GTCAGGTGGCAGAAGGGTCAGGG + Intergenic
1178950367 21:36980747-36980769 CGCAGATGGCAGCGGAGGCATGG + Intronic
1179129425 21:38621445-38621467 CTCTCATGGCAGCGGGGAGATGG - Intronic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179341897 21:40519488-40519510 CTCAGATGGCCAAAGGGGCAAGG - Intronic
1179471959 21:41616610-41616632 GGGAGATGTCAGAGGGGACAGGG - Intergenic
1179654189 21:42834959-42834981 ATCAGAGGCGAGAGGGGACAAGG - Intergenic
1179765883 21:43572623-43572645 CTCAGGTGTCCGAGAGGACAAGG + Intronic
1180432369 22:15264077-15264099 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180514933 22:16132015-16132037 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1181609912 22:24005434-24005456 CCCAGATCGGAGAGGGCACAGGG - Intergenic
1181696296 22:24594485-24594507 CAGAGATGGCAGTGGGGAGAGGG + Intronic
1182059792 22:27388671-27388693 CCCAGATGGGAGAGGGCAGAGGG - Intergenic
1182782100 22:32876198-32876220 CTTACATGGCAGAAGGGGCAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1182920540 22:34075215-34075237 CTCACATGGCAGAAGGGGGAAGG + Intergenic
1183573090 22:38668952-38668974 CACACATGGCAGAGAGGAAAGGG - Intronic
1183594221 22:38800344-38800366 CTCAGAAGGCATGAGGGACAGGG + Intergenic
1183723245 22:39574347-39574369 GTCAGGTGGGAGAGGGGCCAAGG + Intronic
1184142627 22:42586998-42587020 CTCAGGAGGCTGAGGGGAGAGGG + Intronic
1184212503 22:43044129-43044151 GACAGAGGGCAGCGGGGACAGGG - Intronic
1184286323 22:43473695-43473717 CTCAGATGGAGTAGGGGGCAGGG + Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1184686648 22:46099338-46099360 CCCAGATGGCAGAGGGGTCCGGG - Intronic
1184821069 22:46909677-46909699 AGCAGGGGGCAGAGGGGACAGGG - Intronic
1184949909 22:47833922-47833944 CTGAGATTGCAGAGAGGAGACGG + Intergenic
1185117187 22:48944621-48944643 GGCTGATGGCAAAGGGGACAGGG - Intergenic
1185173190 22:49305230-49305252 CTGAGGGGGCAGAGGGGCCAAGG - Intergenic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
952510389 3:34047749-34047771 CTCACATGGCAGAAGAGCCAAGG - Intergenic
953216947 3:40927773-40927795 CTCGGATCGCAGAAGAGACAAGG - Intergenic
953346718 3:42182181-42182203 CTCACGGGGCAAAGGGGACACGG - Intronic
953432857 3:42854078-42854100 CTAAGATGGAAGAGGGGAGATGG + Intronic
953556621 3:43951246-43951268 CTCAGGTGGCTGAGGGGATATGG - Intergenic
953742928 3:45552490-45552512 ATCCCATGGCAGAGGGGAGAGGG + Intergenic
954451958 3:50576509-50576531 CTCAGAAGGCTGAGGTGAGAGGG - Intronic
954525949 3:51271423-51271445 CTCACATAGCAGAAGGGGCAAGG + Intronic
955012016 3:55026711-55026733 GAGAGATGACAGAGGGGACAAGG + Intronic
955241648 3:57183241-57183263 CTCACATGGCAGAAGGGGAAAGG + Intergenic
955986489 3:64578876-64578898 CTCAGATGACAGTGGTCACAAGG - Intronic
956191447 3:66612045-66612067 CTCAGGTGGAAGAGGGGGCAGGG + Intergenic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956774854 3:72556478-72556500 CTCAGATGACAGAAGGAACCAGG + Intergenic
956904019 3:73746830-73746852 CACAGGTGGCTGAGGGCACAAGG + Intergenic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957471219 3:80659316-80659338 CGCAGAAGGCAAAGGGGAAACGG - Intergenic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958577037 3:95964095-95964117 CTCAGATGGCAGAAGGTAGAAGG - Intergenic
958658581 3:97036006-97036028 CTCACAAGGCAGATGGGACAAGG - Intronic
959214361 3:103431779-103431801 CTCATATGGCAGAAGGCAGAAGG + Intergenic
960056664 3:113280709-113280731 CTCCGCTGGCATGGGGGACAAGG + Intronic
960241113 3:115343191-115343213 CTCACACGGCAGAAGGAACAAGG - Intergenic
960271439 3:115678960-115678982 CACAGAAGGTAGAGGTGACAAGG + Intronic
960319872 3:116221404-116221426 CTGGGATGGGAGAGTGGACAAGG - Intronic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
961186669 3:124920895-124920917 CCCACAGGGCAGAGGTGACATGG + Intronic
961826500 3:129601888-129601910 GCCAGATGGCAGTGGGGAGATGG - Intronic
962025244 3:131540888-131540910 CTCAGGTGACAGAGGGGACTCGG + Intronic
962230678 3:133662634-133662656 TTCAGATGGCAGAGAGCAAAGGG + Intergenic
962709021 3:138070134-138070156 CTCAGAGGAGGGAGGGGACAGGG - Intronic
963335223 3:143967489-143967511 TTCGCATGGCAGAAGGGACAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964309631 3:155378899-155378921 CTCACATGGCAGAAGGGGCGTGG + Intronic
965788714 3:172364474-172364496 CTAAGATGGCAGTGGAGGCAGGG - Intronic
966001047 3:174949007-174949029 CTCACATGGCAGAAGAGAAAGGG + Intronic
966417295 3:179702380-179702402 CACAGATGGCAGTGGGGCCAGGG + Intronic
966753118 3:183341374-183341396 TGCAGATGGCAGAGGAGATAGGG + Intronic
967684071 3:192399306-192399328 TTCAAATGGCAGAAGGGGCAAGG - Intronic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
968050956 3:195654653-195654675 CTCTGATGGAAGAAGAGACAGGG + Intergenic
968104869 3:195993685-195993707 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968303164 3:197631269-197631291 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
968465768 4:749891-749913 CCCAGGAGGCAGAGGGTACAGGG - Intronic
968470622 4:780923-780945 CTCAGTGGGCAGCAGGGACAGGG - Intergenic
968624740 4:1622048-1622070 GTCAGGTGGCAGAGGGCAGAGGG - Intronic
968984073 4:3865955-3865977 CACAGGTGGGAGAGGTGACACGG + Intergenic
968994316 4:3936151-3936173 CTCGGATGGCAGGGGTGACCTGG + Intergenic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969188598 4:5498946-5498968 CTCAGGAGGCAGCAGGGACAGGG + Exonic
969268340 4:6080808-6080830 CTGTGCTGGAAGAGGGGACAGGG + Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969547113 4:7837400-7837422 CTCATGTGGCGGAAGGGACAAGG - Intronic
969553880 4:7892897-7892919 TTGAGATGGCAGAGGGCAGACGG + Intronic
969719465 4:8885298-8885320 CTGTGCTGCCAGAGGGGACAGGG + Intergenic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970579101 4:17458033-17458055 CTCAGACAGCAGAGGGCAGAAGG - Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
970756171 4:19429266-19429288 CTCAGCTGGCAGAGATGAGAGGG - Intergenic
970856726 4:20657806-20657828 CTCAGAGGGAAGAGTGGAAAGGG + Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971047178 4:22817783-22817805 CTCATATGGCAGAAGGGGCCAGG - Intergenic
971112612 4:23605880-23605902 CTCACATGGTGGAAGGGACAAGG + Intergenic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971480541 4:27110735-27110757 CTCAGATAGTATAAGGGACAAGG - Intergenic
971504047 4:27347419-27347441 CTCATATGGCAGAAGGAGCAAGG + Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972161573 4:36234300-36234322 CTCACATGGCAGAAGGGCAAGGG + Intronic
972563473 4:40248963-40248985 ATGACATGACAGAGGGGACAGGG + Intergenic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
973627283 4:52785425-52785447 CTCACATGGCAGAAGGGGCCAGG - Intergenic
973942000 4:55920502-55920524 CTGAGATAGCAAAGGGGAAAAGG + Intergenic
974677409 4:65111419-65111441 CTCACATGGCAGATGGGATAAGG - Intergenic
975213206 4:71724709-71724731 CTCACATGGCAGGAGAGACAAGG + Intergenic
975241842 4:72068336-72068358 CTAAGATGGCAGAAGGCATATGG + Intronic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975524311 4:75331982-75332004 GTCAGGAGGCAGAGGGGTCAGGG - Intergenic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976493870 4:85703584-85703606 CTCACATGGCAGAAGAGGCAAGG - Intronic
976512351 4:85926016-85926038 CACAGATGGAAGAGGAGAAAGGG - Intronic
976513969 4:85943418-85943440 CTCAGATGGTGGAAGGTACAAGG + Intronic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977490702 4:97706420-97706442 CTCACATGGCAGAAGGGCAAAGG - Intronic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977756548 4:100678381-100678403 TTCACATGGCAGAAAGGACAAGG + Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
977954360 4:103010303-103010325 CTCACATGGCAGAAGGTATAAGG + Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978090350 4:104707532-104707554 CTCAGGAGGCACAGGGGTCAGGG - Intergenic
978260632 4:106753249-106753271 CTCAGAGGGCCCAAGGGACAGGG - Intergenic
978964443 4:114724597-114724619 CTCACATGGCAGAAGGGAGGAGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
980972149 4:139576794-139576816 CTCACATGGCAGAAGGGGTATGG + Intronic
981133923 4:141189358-141189380 GTCAGGTGGCACAGGGCACAGGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981301698 4:143193979-143194001 CTCAGATGGCTGAGGAGAGAGGG + Intronic
981535072 4:145791254-145791276 CTCACATGGCAGAAGAGGCAAGG + Intronic
981794885 4:148585055-148585077 GTCAGAAGGCACAGGGGTCAGGG + Intergenic
981814415 4:148813783-148813805 TTCAGAGGGGAGAGGGGACAGGG + Intergenic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982527491 4:156497759-156497781 TTCAGATGGCAGAAGGCAGAAGG + Intergenic
982574230 4:157088717-157088739 CTCAGAAGACAGTGGGGAGATGG - Intronic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
983036621 4:162874640-162874662 ACCAGATGGCAGATGTGACAAGG - Intergenic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983656294 4:170088842-170088864 CTCACGTGGCAGAAGGGCCAAGG - Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984176903 4:176430308-176430330 CTCACCTGGCAGAAGGGAAAAGG - Intergenic
984370943 4:178863720-178863742 CCCAGCAGGCAGAGTGGACAGGG - Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985175002 4:187191405-187191427 CTCAGATGCCAGTGAGGACCTGG - Intergenic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
985733318 5:1563671-1563693 CCCTGAAGGCAGAGGGGACTTGG + Intergenic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
986174296 5:5338892-5338914 CTCACATGGCCGAAGGGGCAAGG - Intergenic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
986849203 5:11791148-11791170 CAGAGATGTCAGAGGGAACATGG + Intronic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987838633 5:23194056-23194078 GTCAGATGGCCCAGGGGTCATGG - Intergenic
987992848 5:25237598-25237620 CTCAAATTACAGAGGTGACATGG - Intergenic
988514849 5:31895375-31895397 CTCACATGACAGAGGAGATAAGG - Intronic
988530574 5:32023729-32023751 TACAGATGGCAGTGGGGAGATGG + Intronic
988643307 5:33066044-33066066 CTCAGTTGGCATAGGAGAGAGGG - Intergenic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
989055452 5:37361961-37361983 CTCACATGGCAGAGGGGTAGGGG - Intronic
989137155 5:38167037-38167059 CTCAGAGGGCAGCAGGGCCATGG - Intergenic
989439768 5:41456731-41456753 CTCATATGGTGGAAGGGACAAGG - Intronic
989664493 5:43838022-43838044 CTCACTTTGCAGAGGGCACAAGG - Intergenic
989703439 5:44298317-44298339 CTCAGATGACAGAAGGGAGGAGG - Intergenic
989974879 5:50573085-50573107 CTCAGAAGGCAGTGGGAAAAGGG + Intergenic
989980478 5:50637729-50637751 CTCACATGGTGGAAGGGACAAGG - Intergenic
990532043 5:56683814-56683836 TTCACATGGCAGAAGGGGCAAGG - Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
991349150 5:65702597-65702619 CTCACATGGCAAGAGGGACAGGG + Intronic
991357517 5:65784534-65784556 CTCACATGGCAGAAGGGGGAAGG + Intronic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992227035 5:74628986-74629008 ATCAGATGGGAGTGGGGAGAAGG + Exonic
992268177 5:75038627-75038649 CTCACATGGCAAAGGGCAGACGG + Intergenic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
992950542 5:81852961-81852983 CTCAGATGATGGAGAGGACAAGG + Intergenic
993120102 5:83764693-83764715 TTCACATGGCAGAGGGCAGAAGG + Intergenic
993274831 5:85843832-85843854 CGCAGATGGCAGAGCTGAAAGGG - Intergenic
993460093 5:88172606-88172628 GTCAGAAGGCACAGGGGTCAGGG + Intergenic
993635690 5:90340786-90340808 CTCAGATTTCAGTGGGTACATGG - Intergenic
993748291 5:91630239-91630261 CTCACATGGCAGAGGGTGAAAGG - Intergenic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994634427 5:102326502-102326524 CTCAGAAGACAGAGGGGATAAGG - Intergenic
995058582 5:107789314-107789336 CTCACATGGTGGAAGGGACAAGG - Intergenic
995593058 5:113719787-113719809 CTCACATGGCAGAAGGTAAAAGG - Intergenic
996001849 5:118373852-118373874 CTCAGAAGGCAGAGGGAGTAAGG - Intergenic
996529205 5:124510026-124510048 ATCAGATGGCAGATGGGGCTGGG + Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
997997083 5:138595654-138595676 CTCTGCAGCCAGAGGGGACAGGG + Intergenic
1000013603 5:157257439-157257461 CTCATATGGCAGAAGGGTAAAGG - Intergenic
1000315793 5:160089385-160089407 CAGAGATGGCAGCGGGGACGGGG + Intronic
1000368452 5:160512130-160512152 CTTGGATGGTAGTGGGGACAAGG + Intergenic
1000423410 5:161062620-161062642 CTCACATGGCGGAAGGGGCAAGG - Intergenic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1001274814 5:170342781-170342803 CCCAGATGGGTGGGGGGACAGGG + Intergenic
1001722446 5:173867755-173867777 CTCAGTTGGCAGATCAGACAAGG - Intergenic
1002062918 5:176637067-176637089 CTCAGAAGTCAGAGGGAGCAGGG - Intronic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1002703290 5:181142449-181142471 ATCAGAGGGCTGAGGGGAGACGG - Intergenic
1003004092 6:2364547-2364569 ATCAGATGACAGAGAGGTCATGG + Intergenic
1003308597 6:4949606-4949628 CTGAGATGGCTGAGTGCACAGGG - Intronic
1003378069 6:5597400-5597422 CTCATAGGCCAGAGGGGAAAGGG - Intronic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1005011496 6:21340158-21340180 AGCACATGGAAGAGGGGACATGG - Intergenic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1006804315 6:36778440-36778462 CTCAGAGGGCTGTGAGGACAGGG + Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1008523923 6:52388577-52388599 CTCACATGGCAGAAGAGGCAAGG - Intronic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1009670014 6:66736496-66736518 CTCAGATGGCGTAAAGGACATGG - Intergenic
1009845168 6:69125490-69125512 TTCACATGGCAGAAGGGGCAAGG - Intronic
1010008091 6:71017694-71017716 CTCAGGTGGCTGAGGTGAGAGGG + Intergenic
1011332688 6:86227825-86227847 GTCAGAAGGCACAGGGGTCAGGG + Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1011890328 6:92151244-92151266 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1012083013 6:94784899-94784921 CTCAGGAGGCACAGGGGTCAGGG + Intergenic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1012972131 6:105742676-105742698 GTCAGAGGGCAGAAGGCACAGGG - Intergenic
1013626203 6:111939790-111939812 CACAGATGGGAGAGGTGACATGG - Intergenic
1013675694 6:112459389-112459411 CTCATATGGTAGAAGGGACAAGG - Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1014112606 6:117636424-117636446 CTCAGGAGGCTGAGGGGAGAGGG - Intergenic
1014269072 6:119315575-119315597 ACCAAATGGCAGAGGGTACAGGG + Intronic
1014388568 6:120832101-120832123 CTCAGGAGGCTGAGGGGAAAGGG + Intergenic
1015210112 6:130687249-130687271 CTCACATGGCAGAAGGCACCAGG + Intergenic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1016026686 6:139294572-139294594 CTCACATGGCAGAGGGGTAAGGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1016881321 6:148915022-148915044 CTCACATGGTGGAGGGGGCATGG + Intronic
1016904640 6:149136765-149136787 CTCACATGGCAGAAGGGGAAGGG + Intergenic
1017054774 6:150426811-150426833 CTGGAATGGCAGTGGGGACATGG - Intergenic
1017122989 6:151041377-151041399 CTGAGATGACTGAGGGGACGGGG + Intronic
1017192374 6:151668237-151668259 CTCATATGGCAGAAGGTAGAAGG + Intronic
1017751228 6:157492152-157492174 CTCAGGTGGCAGAGAAGCCAAGG - Intronic
1017904274 6:158746089-158746111 CTCCCATGGTAGAAGGGACAAGG + Intronic
1018056110 6:160053817-160053839 CTCAGGAGGCTGAGGTGACAGGG - Intronic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1018170767 6:161141383-161141405 ATCAGATGGTGGAGGAGACAAGG + Intronic
1018219595 6:161565047-161565069 CCCAGATGAGAGAGAGGACAGGG - Intronic
1018321612 6:162616190-162616212 TTCAGAAGGCAGTGGGGTCAGGG - Intronic
1018615466 6:165682569-165682591 CTCACATGGCAGAGAGGCAAAGG - Intronic
1018636266 6:165861764-165861786 GTTTGATGGCAGAGGTGACAAGG + Intronic
1019442699 7:1055502-1055524 CGCAGGTGGGAGAGGGGACGTGG + Intronic
1019844303 7:3481684-3481706 CTGAGAGGACAGAGTGGACAGGG - Intronic
1020034718 7:4958085-4958107 CCCAGGTGGCAGAGGGGGAAAGG + Intronic
1020187791 7:5972072-5972094 CTCACGTGGCAGAAGGGACTCGG - Intergenic
1020295125 7:6752698-6752720 CTCACGTGGCAGAAGGGACTCGG + Intergenic
1021166942 7:17353907-17353929 CTCAGGAGGCACAGGGGTCAGGG + Intergenic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021621874 7:22556953-22556975 CTCAGAAAGCACAGGGCACAAGG - Intronic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022284614 7:28943527-28943549 CTCAGATGACAGAGGAGAGGAGG - Intergenic
1023838204 7:44080651-44080673 CTCAGCTGGGACAGGTGACATGG - Intronic
1024009098 7:45252608-45252630 CTCACATGATGGAGGGGACAAGG + Intergenic
1024241955 7:47442682-47442704 GTCAGATGGCAGAGGTGAATGGG + Intronic
1024259048 7:47560258-47560280 CTCACATGGTAGAGGGGTGAGGG - Intronic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1026678251 7:72446413-72446435 CTCAAAAGGCACAAGGGACAGGG + Intronic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027233507 7:76284950-76284972 CCTTGATTGCAGAGGGGACAGGG + Intronic
1027429095 7:78091337-78091359 CTCACATGGCAGATGGCAGAAGG - Intronic
1027469465 7:78555029-78555051 CTCAGAAGGCTGAGGTGAGAGGG + Intronic
1027554688 7:79648496-79648518 CTCAGATGTCAGTGGGATCATGG + Intergenic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028892948 7:96009326-96009348 CTCAGATGCTAATGGGGACAGGG - Intronic
1030074019 7:105721187-105721209 CTCAGCTGGCACAGGAGAGAGGG + Intronic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030662364 7:112234403-112234425 TTTACATGGCAGAAGGGACAAGG + Intronic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1031417349 7:121509703-121509725 CTCTGGTGGTAGAGGGGAAAGGG + Intergenic
1031991708 7:128202960-128202982 CTGAGATCGCACAGGGCACAGGG - Intergenic
1032016030 7:128380955-128380977 CTCAGATCTCAGAGGAGACAGGG - Intergenic
1032082189 7:128865241-128865263 CCCAGAGGGCACAGAGGACAAGG - Intronic
1032413979 7:131722165-131722187 CTCTGATGCTGGAGGGGACATGG + Intergenic
1033980217 7:147155214-147155236 CTCACATGGCAGAAGGCTCAAGG - Intronic
1034055576 7:148031709-148031731 CTGAGATTGCTGAGTGGACAAGG + Intronic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034446615 7:151117047-151117069 GTCAGAGGGCAGAGGGCACGAGG - Intronic
1034534761 7:151719848-151719870 CTCAGTAGGCACAGGGGCCAGGG - Intronic
1034922211 7:155092756-155092778 CTCACATGGCAGAAGGCAAAGGG - Intergenic
1034939528 7:155221229-155221251 CTCAGCCAGCAGAGGTGACAGGG + Intergenic
1034999910 7:155604282-155604304 CTTACATGGCAGAAGGGACGTGG + Intergenic
1035144249 7:156797588-156797610 CTGAGCTGGCAGTGGGCACAGGG + Intronic
1035360428 7:158309959-158309981 CTCATGTGGCAGACGGGGCAAGG - Intronic
1035362488 7:158322635-158322657 CCCAGTGGGCAGTGGGGACAAGG + Intronic
1035401562 7:158569553-158569575 CTCACCAGGAAGAGGGGACACGG + Intronic
1035760048 8:2062255-2062277 CCCAGAGGGCTGAGGGGAGAAGG + Intronic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036493250 8:9247175-9247197 CTCAAATGGCAAAAGGGACTTGG - Intergenic
1036687554 8:10922018-10922040 CTTACATGGCAGAGGGCAGAAGG - Intronic
1037404679 8:18528984-18529006 CTCAGAGGGGAGTGTGGACAAGG + Exonic
1037586912 8:20283337-20283359 TTCAGATGGTGGAAGGGACAAGG - Intronic
1037658441 8:20907231-20907253 CTCAGGTGGCTCAGGGAACAAGG - Intergenic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1037794283 8:21978834-21978856 ATTAGAGGGCAGAGGGAACAGGG - Intronic
1037817254 8:22118781-22118803 CAGAGAAGGCAGAGGGGACCCGG - Intronic
1038048442 8:23787079-23787101 GTGAGAGGGCAGAGGGGAAAAGG + Intergenic
1038082065 8:24149880-24149902 CTCAGAGTGCTGATGGGACATGG - Intergenic
1038254818 8:25941614-25941636 CTCAGATGGAGGAGGAGTCATGG - Intronic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038397355 8:27257149-27257171 GTGAGAAGGCAGAGGGGAAAAGG - Intronic
1038456262 8:27673669-27673691 CTCAGATGTCAGTGGGGAGGAGG - Intronic
1038672434 8:29592995-29593017 CTCAGAAGGCAGAGGCTGCAGGG + Intergenic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1040433644 8:47368115-47368137 CTCACATGGTGGAAGGGACAAGG + Intronic
1040473802 8:47759585-47759607 GTCAGAAGGCACAGGGGTCAGGG + Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1040946273 8:52888023-52888045 CTCATATGGCAGAGGGAGGAAGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041403663 8:57472474-57472496 CTCACATGGCAGAGGGTGGAAGG + Intergenic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041454716 8:58045956-58045978 TTCACAAGGCAGAAGGGACAAGG + Intronic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1042400347 8:68338157-68338179 CTCATATGGCAGAAGGCAGAAGG + Intronic
1042474687 8:69233818-69233840 CTCACATGACAGAGGGCAGAAGG + Intergenic
1042699450 8:71596077-71596099 CTTAGATGGCAGAAGGCAAAAGG - Intergenic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044639605 8:94364981-94365003 CTCACATGGTGGAAGGGACAAGG - Intergenic
1045062926 8:98424390-98424412 CTCAGCTGGGGAAGGGGACAAGG + Intronic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1046844131 8:118896763-118896785 CCCATATGGCAAAGAGGACAAGG - Intergenic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047413201 8:124641115-124641137 CTCATCTGGGGGAGGGGACATGG + Intronic
1047778946 8:128096422-128096444 CTCAGCTGGTACAGGGGACAGGG - Intergenic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1049367589 8:142248138-142248160 CTCAGGTGGCAGAAGGCAGAGGG - Intronic
1049730310 8:144174025-144174047 CTCAGTTGGCAGAGGGGAGGTGG - Intronic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050129100 9:2391119-2391141 ATAAGATGGCAGAGAGCACAAGG + Intergenic
1050240576 9:3630364-3630386 CTCACATGGCAGAGGTGAATGGG - Intergenic
1050514716 9:6430790-6430812 GTCAGGAGGCAGAGGGAACAGGG - Intronic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1051390537 9:16558525-16558547 AGAAAATGGCAGAGGGGACAGGG - Intronic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1051677313 9:19571269-19571291 CATAGAAGGCAGAGGAGACAAGG + Intronic
1053046058 9:34918191-34918213 CACAGTTGGCAGAGGGGTGATGG - Intergenic
1053122040 9:35554968-35554990 CAGAGATGGGAGAGGGGAGAGGG - Intronic
1053684368 9:40507511-40507533 CTGAGATGACTGAGGGGACAGGG + Intergenic
1053934337 9:43135797-43135819 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054279357 9:63117442-63117464 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054297462 9:63342975-63342997 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054395480 9:64647483-64647505 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054430126 9:65152683-65152705 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054500257 9:65868849-65868871 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054861872 9:69962195-69962217 CTGAGTGGGGAGAGGGGACAGGG + Intergenic
1054869431 9:70035801-70035823 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1055338917 9:75261422-75261444 CTCAGGAGGCACAGGGGTCAGGG + Intergenic
1055848159 9:80592935-80592957 CTCATATGGCATATGGCACAAGG - Intergenic
1056423335 9:86451786-86451808 CTCAAATGGCAGAAGGTAGAAGG + Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056604933 9:88077823-88077845 CTCTCATGGGAGAGGGGAGAGGG + Intergenic
1056710058 9:88985097-88985119 CTCAGCTGGCAGAGGTGATGAGG - Intergenic
1056798595 9:89675739-89675761 CTGCAAGGGCAGAGGGGACAGGG + Intergenic
1057302853 9:93896581-93896603 CTCAGACTGGAGGGGGGACAGGG - Intergenic
1057420124 9:94905423-94905445 CTCAGATAACAGAGGTGAGATGG + Intronic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059133912 9:111784814-111784836 CTCACATGGCAGAAAGGTCAAGG + Intronic
1059489470 9:114655246-114655268 CTCACATAGCAGAAGGGGCAAGG - Intergenic
1059502680 9:114768473-114768495 CTCACATGGTAAAAGGGACAAGG - Intergenic
1060423933 9:123489024-123489046 CTCAGCTGGCATAGGGCAGAGGG - Intronic
1060665936 9:125432188-125432210 CCCAGATGGCTGAAGGGCCAGGG - Intergenic
1061279064 9:129586702-129586724 TTCAGCAGGCAGAGGGGAGAGGG - Intergenic
1061866180 9:133492849-133492871 CACAGCTGGCAGAGGGCGCAGGG - Intergenic
1061958863 9:133977888-133977910 CTCAGCTGGCAAAGGGGATGGGG + Intronic
1185713999 X:2326725-2326747 CTTTGAGGGCAGAGAGGACACGG - Intronic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1186054866 X:5639400-5639422 CTCACATGGTGGAAGGGACAAGG - Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1187426228 X:19179860-19179882 CTCACATGGCATAAGGGGCAGGG - Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188293515 X:28417571-28417593 CTCACATGGCAGAAGGGGCGAGG + Intergenic
1188678214 X:32969071-32969093 CTCACATGGTGGAGGGGAAAGGG - Intronic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1190211781 X:48454558-48454580 CTCATATGGCAGAAGGCAGAAGG - Intergenic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190397950 X:50003691-50003713 CTGAGATGGGAGAAAGGACATGG - Intronic
1191146422 X:57170585-57170607 CTCAGAAGGCAGAGTGTAGAAGG - Intergenic
1192852044 X:74967223-74967245 CTCTGATGGCACTGGGGAAATGG + Intergenic
1193136955 X:77983015-77983037 CTCACATGGTGGAAGGGACAGGG + Intronic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193728681 X:85076044-85076066 CTCACATGGCAGAGAAGAGAGGG + Intronic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1199001321 X:142640400-142640422 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199736062 X:150687759-150687781 CTCACATGGCAGAAGGTAAAAGG - Intergenic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic
1200119394 X:153783275-153783297 CTCAGATGGGAGAGGAGGCATGG - Intronic
1200326003 X:155240024-155240046 CTCATGTGGCAGAAGGGGCAAGG + Intergenic
1200740216 Y:6846294-6846316 GTCAGCAGGCACAGGGGACAGGG + Intergenic
1201676098 Y:16586103-16586125 CTCACATGGCAGAAGGGGCGAGG - Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic