ID: 1041036793

View in Genome Browser
Species Human (GRCh38)
Location 8:53799807-53799829
Sequence CTGTAAACTCAGATGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 959
Summary {0: 1, 1: 2, 2: 21, 3: 123, 4: 812}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041036793_1041036797 4 Left 1041036793 8:53799807-53799829 CCCTCTGCCATCTGAGTTTACAG 0: 1
1: 2
2: 21
3: 123
4: 812
Right 1041036797 8:53799834-53799856 AAGATGGCCATTTATGAATGAGG No data
1041036793_1041036799 11 Left 1041036793 8:53799807-53799829 CCCTCTGCCATCTGAGTTTACAG 0: 1
1: 2
2: 21
3: 123
4: 812
Right 1041036799 8:53799841-53799863 CCATTTATGAATGAGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041036793 Original CRISPR CTGTAAACTCAGATGGCAGA GGG (reversed) Intronic
900686967 1:3954789-3954811 CTGGACAGTCACATGGCAGAGGG - Intergenic
900980630 1:6044191-6044213 CTATAAAGTCACATGGCAAAGGG + Intronic
901100812 1:6717182-6717204 CTGTTTCCTCATATGGCAGAAGG + Intergenic
901745201 1:11368268-11368290 CTGCCAAGTCACATGGCAGAGGG - Intergenic
901908899 1:12438302-12438324 CTGTAACCTCACACGGTAGAAGG - Intronic
902154348 1:14472080-14472102 CTGCTTACTCACATGGCAGAAGG + Intergenic
902287823 1:15417913-15417935 CTGCACAGTCTGATGGCAGAAGG - Intronic
902445808 1:16463437-16463459 CTGTAACCTCACATGGTAGAAGG + Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903127973 1:21260640-21260662 CTGTGAACCCAACTGGCAGAGGG - Intronic
903441521 1:23391518-23391540 CTGTAACCTCACATGGTGGAGGG - Intronic
904114517 1:28151745-28151767 CTGTGACCTCACATGGCAAAAGG - Intronic
904299235 1:29543467-29543489 CTGCATCCTCACATGGCAGAAGG - Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
904393563 1:30202256-30202278 CTGTATCCTCACATGTCAGAAGG + Intergenic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905534019 1:38704872-38704894 TTGTAATCTTACATGGCAGAAGG - Intergenic
906173672 1:43749861-43749883 CTGTGTCCTCATATGGCAGAAGG - Intronic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
907877263 1:58503660-58503682 TTGTAACCTCACATGGTAGAAGG - Intronic
907927824 1:58971099-58971121 CAGCAAAGTCAGATGGCAAAGGG + Intergenic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908962950 1:69723801-69723823 CTGTAACCTCACATGGTAGAAGG + Intronic
909107696 1:71433122-71433144 CCGTATCCTCACATGGCAGAAGG - Intronic
909875495 1:80797671-80797693 CTATATTCTCACATGGCAGAAGG + Intergenic
909878833 1:80847465-80847487 CTGTGTACTCACATGGCAGAAGG + Intergenic
910120395 1:83782155-83782177 CTGAAAACTTGGATGTCAGAAGG - Intergenic
910239038 1:85066407-85066429 GTGTGAACTCAGGAGGCAGACGG - Intronic
911216864 1:95204081-95204103 CTGTAACCTCACAGGGCAGAGGG - Intronic
911254873 1:95621603-95621625 CTGTGACCTCACATGGCAGAAGG - Intergenic
911366903 1:96949544-96949566 CTGTCACCTCAGGTGGCAGAAGG + Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
912367330 1:109145186-109145208 CTGCATCCTCACATGGCAGAAGG - Intronic
913066006 1:115255584-115255606 CTATAGCCTCACATGGCAGAAGG - Intergenic
913386210 1:118260710-118260732 CTGTAACCTCACATGGTAGAAGG - Intergenic
913435247 1:118840957-118840979 CTGCATCCTCACATGGCAGAAGG + Intergenic
913594436 1:120359775-120359797 GTGTACACACAGATGGCTGAAGG - Intergenic
913996028 1:143652458-143652480 CTGTAAGCTCAGAGGGGAGCCGG - Intergenic
914092826 1:144519209-144519231 GTGTACACACAGATGGCTGAAGG + Intergenic
914305702 1:146414664-146414686 GTGTACACACAGATGGCTGAAGG - Intergenic
914596353 1:149158142-149158164 GTGTACACACAGATGGCTGAAGG + Intergenic
915663096 1:157419946-157419968 CTGTGTACTCACATAGCAGAAGG - Intergenic
915863388 1:159471778-159471800 CTGTGTCCTCAGTTGGCAGAAGG - Intergenic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
916816982 1:168363683-168363705 CTGCAACCTCACATGGCAGAAGG - Intergenic
917246992 1:173014169-173014191 CTGCAGCCTCACATGGCAGAAGG - Intergenic
917265904 1:173220669-173220691 CTGTATCCTCACATGGCAGAGGG - Intergenic
917785776 1:178456124-178456146 ATGGAAACTCAGTTGGCAGTGGG + Intronic
918248502 1:182681354-182681376 CTGTAGACTCTGATGGCAAATGG - Intronic
918356949 1:183713628-183713650 CTGTGACCTCACATGGTAGAAGG - Intronic
918507935 1:185278314-185278336 CTGTGTTCTCACATGGCAGAAGG - Intronic
918681990 1:187367328-187367350 CTGCATCCTCACATGGCAGAAGG + Intergenic
918841188 1:189541755-189541777 CTGTAACTTCATATGGCAGAAGG - Intergenic
918961136 1:191279682-191279704 CTGTGTTCTCACATGGCAGAAGG + Intergenic
919729264 1:200902448-200902470 CAGTAAACTCAGAAGACAGTGGG + Intronic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
920252803 1:204633143-204633165 CTGTTTCCTCACATGGCAGAAGG - Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920429515 1:205908119-205908141 CTGTAACCTCACACGGCAGAGGG + Intergenic
920670575 1:208001037-208001059 CTGTAACCTCACATAGCAGAAGG - Intergenic
920947083 1:210539668-210539690 GTGTAAACTGATATTGCAGAGGG + Intronic
921502200 1:215918425-215918447 CTCTAACTTCACATGGCAGAAGG - Intronic
922332596 1:224590557-224590579 CTGTATCATCACATGGCAGAAGG + Intronic
923027516 1:230217744-230217766 CTGTATCCTCACATGGCAGAAGG + Intronic
923405574 1:233655697-233655719 CTCTAATCTCACAAGGCAGAAGG - Intronic
923608944 1:235472071-235472093 TAGAAAACTCAGAGGGCAGATGG - Intronic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923887089 1:238169936-238169958 TTGTAACCTCACATGGCTGAAGG + Intergenic
923967121 1:239154445-239154467 CTGTAATCTTAAATGGCAGAAGG - Intergenic
924072652 1:240297912-240297934 CTGTAACCTCACATGGTAGAAGG + Intronic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924498812 1:244616540-244616562 CTGCATCATCAGATGGCAGAAGG + Intronic
924576497 1:245285399-245285421 CGGCAAAGTCACATGGCAGAAGG + Intronic
924863514 1:247952477-247952499 CTGTGACCTCACATGGTAGAAGG - Intronic
924867990 1:248006764-248006786 CTGTGACCTCACATGGTAGAAGG - Intronic
924872533 1:248064297-248064319 TTGTAACCTCACATGGTAGAAGG - Intronic
1062917409 10:1251831-1251853 CTGTATCCTCACATGGCAGATGG - Intronic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063167662 10:3478763-3478785 CAGTATAATCAGCTGGCAGAAGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063600063 10:7473086-7473108 CTGTTACCTTAGATGGCAAAGGG - Intergenic
1063967587 10:11359010-11359032 CTGTATCCTCACATGGCAGAAGG - Intergenic
1064004210 10:11687516-11687538 CTGGAATTTCAGATGTCAGAAGG + Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1064874514 10:19977719-19977741 CTGTAACCTCACATGGCAGAGGG + Intronic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065460343 10:25956070-25956092 CTGTGTTCTCACATGGCAGAAGG + Intronic
1065871379 10:29959139-29959161 CTGTATCTTCACATGGCAGAAGG - Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1066444338 10:35468186-35468208 GTGTAACCTCACATGGCAAAAGG + Intronic
1066557377 10:36629076-36629098 CTATAACCTCACATGGCAGAAGG - Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1067914627 10:50384015-50384037 CTGTACTCTCATGTGGCAGAAGG - Intronic
1068068793 10:52169381-52169403 CTGTAACCTCACATGGCAGAAGG + Intronic
1068314865 10:55327181-55327203 ATGTATCCTCACATGGCAGAAGG - Intronic
1068659658 10:59611115-59611137 CTGTGTCCTCAGATGGCAGGGGG - Intergenic
1068902669 10:62287487-62287509 ATGTATCCTCACATGGCAGAAGG + Intergenic
1069183537 10:65393410-65393432 CTGCAACCTCACATGGCAGAGGG + Intergenic
1069472780 10:68707689-68707711 CTGTCAACTGAGATTCCAGAAGG - Intergenic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069787767 10:71000207-71000229 CTGTGTCCTCATATGGCAGATGG + Intergenic
1069899029 10:71696396-71696418 CTGTAATCTCACAAGGCAGAGGG + Intronic
1070688867 10:78510120-78510142 CTATGACCTCACATGGCAGAAGG + Intergenic
1070706698 10:78644827-78644849 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1071388307 10:85144035-85144057 CTGCATCCTCACATGGCAGAAGG - Intergenic
1071533516 10:86407993-86408015 CTGCATCCTCACATGGCAGAAGG + Intergenic
1071714311 10:88079700-88079722 CTGCAAAGTCATATGGCAAAAGG + Intergenic
1071921274 10:90353541-90353563 ATGTAAACTTAGATTGCAGAGGG + Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072391090 10:94987771-94987793 CTGTATCCTTATATGGCAGAAGG + Intronic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072555407 10:96511036-96511058 CTGTGGACTCAGAATGCAGAGGG - Intronic
1072642373 10:97221612-97221634 CTGTAACCTCACATGGTGGAAGG - Intronic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073636730 10:105206903-105206925 CTGGAATCTCAACTGGCAGATGG + Intronic
1073697563 10:105888134-105888156 CTGCAAACTTAGGTGTCAGATGG + Intergenic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073806752 10:107106867-107106889 TTGTATCCTCACATGGCAGAAGG - Intronic
1073874214 10:107902471-107902493 CTGTAGCCTTACATGGCAGAAGG - Intergenic
1074244995 10:111680770-111680792 CTGCATCCTCATATGGCAGAAGG - Intergenic
1074850165 10:117433035-117433057 CTGTGGTCTCAGATGGCAGATGG + Intergenic
1075009170 10:118853272-118853294 CTGTATCCTCACATGGCAGAGGG + Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075872393 10:125780251-125780273 CTGTGTCCTCATATGGCAGACGG - Intergenic
1075904886 10:126072485-126072507 CTCTAATCTCAGCTGGCAGATGG - Intronic
1076004702 10:126939138-126939160 CTGTGCCCTCACATGGCAGAAGG + Intronic
1078258873 11:9685504-9685526 CTGTATCCTCACATGGCAGAAGG + Intronic
1078379341 11:10825970-10825992 ATGTACCCTCACATGGCAGAAGG - Intronic
1078391310 11:10937755-10937777 CTGAAAACTCAGATTGCAAGTGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080174114 11:29341301-29341323 CTATCAGCTCACATGGCAGAAGG + Intergenic
1080695034 11:34596061-34596083 CCGTGACCTCACATGGCAGAAGG - Intergenic
1080783385 11:35451834-35451856 CTGTATCCTCATGTGGCAGAAGG - Intronic
1081312415 11:41590165-41590187 TTGAAAACCCAGATGACAGAGGG - Intergenic
1081506885 11:43727123-43727145 CTGTATACTCAGATAGCATATGG + Intronic
1082243858 11:49897677-49897699 ATGTAAATTCACATGGCATAAGG - Intergenic
1082687510 11:56259080-56259102 CTGCATCCTCACATGGCAGAAGG + Intergenic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084836940 11:71809147-71809169 CTGCAACACCAGATGGCAGAAGG - Intergenic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1087238201 11:95744696-95744718 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1087448468 11:98286122-98286144 CTGTGACATCACATGGCAGAAGG - Intergenic
1087512463 11:99115009-99115031 GTGTAACCTCACATGGAAGAAGG - Intronic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1088210438 11:107448755-107448777 CTCTAACCTCATATGGCAGAAGG - Intronic
1088338555 11:108736710-108736732 CTGCATCCTCACATGGCAGAAGG - Intronic
1088717054 11:112558041-112558063 ATGTTACCTCATATGGCAGAAGG + Intergenic
1088937733 11:114420455-114420477 CTGTATTCTCACATTGCAGAAGG - Intronic
1089103773 11:115985241-115985263 TTGTGAACTCACGTGGCAGAAGG - Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1089645957 11:119879211-119879233 CTGTGCCCTCACATGGCAGAAGG + Intergenic
1089827024 11:121287317-121287339 CTGTAAACTCACATGGCAGCAGG + Intergenic
1090374472 11:126279280-126279302 CTGCATCCTCACATGGCAGAAGG + Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090884000 11:130860402-130860424 CTGTAACTTCACATGTCAGAAGG - Intergenic
1091539901 12:1450346-1450368 GAGTAAAATCAGAAGGCAGATGG - Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1091701675 12:2667392-2667414 GAGGAAACTCAGATGGCAGGAGG + Intronic
1092467688 12:8748089-8748111 CTGTATACTTAGATGACAGTAGG + Intronic
1092566426 12:9671114-9671136 CTTTAAGCTCATGTGGCAGACGG + Intronic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092787709 12:12043238-12043260 CTGTATCCTTACATGGCAGAAGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1095039462 12:37425383-37425405 CTGTGCCCTCACATGGCAGAAGG + Intergenic
1095143142 12:38691789-38691811 CTGTATCCTCACATCGCAGAAGG + Intronic
1095671519 12:44866071-44866093 CTGTATCCTCACATGGCAGAAGG - Intronic
1095751650 12:45719230-45719252 CTGTAACCTCACAAGGCAGAAGG + Intergenic
1095919948 12:47518848-47518870 CTGTAAACTCAGTAGGTAAATGG + Intergenic
1096384545 12:51186379-51186401 CTGTAACCTCACATGGTGGAAGG - Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097561625 12:61213881-61213903 CTGTATTTTCACATGGCAGAAGG + Intergenic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098300428 12:69048529-69048551 CTGTAACCTCATGTGGTAGAGGG + Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099494473 12:83329041-83329063 CTGTATCCTCACATGGTAGAAGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1100372874 12:93984818-93984840 CTGTAACCTTATATGGCAGAAGG - Intergenic
1100685600 12:96983584-96983606 CTGTATCCTCACATGACAGAGGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100759040 12:97785941-97785963 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1100762703 12:97826888-97826910 CTATAACCTCATGTGGCAGAAGG - Intergenic
1100923924 12:99522284-99522306 CTGTAAATTTAGGTGGCACAGGG - Intronic
1101309261 12:103561464-103561486 ATGTAAACTCACACAGCAGAAGG + Intergenic
1101522359 12:105495634-105495656 GTGTAAAGTCACATGGCAAAGGG + Intergenic
1101550149 12:105754035-105754057 CTGTAATCTCAGATCTCTGATGG - Intergenic
1101691716 12:107088530-107088552 CTGTCTCCTCACATGGCAGAAGG - Intronic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102750823 12:115292514-115292536 CTGTAACCTCACATGGCCGAAGG + Intergenic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG + Intergenic
1104145185 12:126026485-126026507 CAGTAAACTCAAATGGCAACAGG + Intergenic
1104310546 12:127650920-127650942 CTGTAACCTCACAGGGCAGAAGG + Intergenic
1104788279 12:131465892-131465914 CCATAAACTCAGCTGCCAGAAGG - Intergenic
1105519317 13:21117366-21117388 CTGTGTCCTCATATGGCAGAGGG + Intergenic
1105797820 13:23873815-23873837 CTGTAAACTCACATTGCCTAAGG - Intronic
1106101641 13:26698520-26698542 CTGAAAAATCAGCTGGCAAAAGG - Intergenic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1107252556 13:38381465-38381487 CTGTGCCCTCACATGGCAGAAGG + Intergenic
1107371363 13:39753255-39753277 CTGTAACGTCACATGGTAGAAGG - Intronic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107603516 13:42037645-42037667 CTTTAACCTCACATGGCAGAAGG + Intergenic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1108033789 13:46265518-46265540 CTCTAATCTCACATGACAGAAGG + Intronic
1108362936 13:49684063-49684085 CTTTAAAGACAGAAGGCAGACGG + Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108910313 13:55541977-55541999 CTCTAACCTCACATGACAGAAGG + Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109436730 13:62313254-62313276 CTTTAACCTCACATGGTAGAAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109874259 13:68378754-68378776 CTGTGTACTCACATGGCAGAAGG + Intergenic
1109982188 13:69923796-69923818 CTGCCAACTCAGAAGGCAGCAGG - Intronic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110379994 13:74839370-74839392 CTGTAAGATCACATGGCAAAAGG + Intergenic
1110677076 13:78261448-78261470 CTTTAACCTCACATGGCAGAAGG - Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1111408734 13:87845774-87845796 CTGTCATCTCACAAGGCAGAGGG - Intergenic
1112243914 13:97710833-97710855 CTGTAAAGTCACATGGCAATGGG - Intergenic
1112263731 13:97902937-97902959 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1112732539 13:102381443-102381465 CTGCATCCTCACATGGCAGAAGG - Intronic
1112789942 13:102992152-102992174 CTCTAACCTCACATGGCAGAGGG + Intergenic
1112906575 13:104429747-104429769 CTGTGTCCTAAGATGGCAGAAGG + Intergenic
1112950649 13:104991972-104991994 CTGTTAACCAATATGGCAGAGGG + Intergenic
1113501189 13:110775719-110775741 CTGTGACCTCACATGGCAAAAGG - Intergenic
1113548284 13:111171887-111171909 CTGCAAACTCACATGGCACGGGG - Intronic
1113714269 13:112492165-112492187 TTCTAAAATCAGATGGCAAAAGG - Intronic
1113971362 13:114193475-114193497 CTGTGTCCTCATATGGCAGATGG + Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114138272 14:19879421-19879443 CTGGAAACTCTGGTGGCAGCTGG - Intergenic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1114739688 14:25082607-25082629 CTGTAACCTCACATGGCAGAAGG - Intergenic
1115041379 14:28933242-28933264 CAGTAAAGTTAGATGGCATATGG - Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115738348 14:36359889-36359911 CTGAAAAATCACATGGCAAAGGG - Intergenic
1115859548 14:37668697-37668719 CTGCAAAGTCACATGGCAAAAGG + Intronic
1116334022 14:43634254-43634276 CTGTGACCTCACATAGCAGAAGG + Intergenic
1116699084 14:48215455-48215477 CTGCATCCTCACATGGCAGAAGG - Intergenic
1117187175 14:53252005-53252027 CAGTAAACTCATAAGCCAGAAGG - Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117218342 14:53575540-53575562 CTCTAACCTCATGTGGCAGAAGG + Intergenic
1117287817 14:54304270-54304292 CTGTAGTCTCATATGGCAGAAGG - Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1117748654 14:58898001-58898023 CTGTCTTCTCACATGGCAGAAGG + Intergenic
1118050888 14:62026422-62026444 CTGCATCCTCACATGGCAGAAGG + Intronic
1118429860 14:65706647-65706669 CTGTATCCTCACATGGTAGAAGG + Intronic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118890872 14:69907861-69907883 CTCTAATCTTACATGGCAGAAGG + Intronic
1119609133 14:76047002-76047024 CTATGGACTCACATGGCAGAAGG + Intronic
1120150075 14:81022946-81022968 CTGTGTCCTTAGATGGCAGAAGG - Intronic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1121141509 14:91546592-91546614 CTGTATTTTCACATGGCAGAAGG - Intergenic
1121164374 14:91777774-91777796 CTGTAACCTTAGCTGGTAGAAGG + Intronic
1121297929 14:92844999-92845021 CTGTAACCTTACATGGCAGAAGG + Intergenic
1121625299 14:95381046-95381068 CTCTAACCTCATGTGGCAGAAGG - Intergenic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1121979403 14:98441549-98441571 CTGTTTTCTCACATGGCAGAAGG + Intergenic
1122038901 14:98968223-98968245 CTGTATCTTCACATGGCAGAAGG - Intergenic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1123889995 15:24768145-24768167 CTGAAAAATCAGCTGGCAAAAGG + Intergenic
1124839541 15:33229014-33229036 CTTTGTACTCACATGGCAGAAGG + Intergenic
1125177390 15:36840126-36840148 CTGTAAGCTCAGATGTCAATGGG - Intergenic
1126124149 15:45280081-45280103 CTGTAACCTCACATGGCAGAAGG - Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1126964029 15:54030786-54030808 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1127241597 15:57121594-57121616 CTGTATCTTCAAATGGCAGAAGG - Intronic
1127542313 15:59952894-59952916 CTCTAACCTCAAATGGTAGAAGG + Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128710719 15:69869456-69869478 CTGTACTCTCACATGGCCGAAGG + Intergenic
1129606291 15:77026682-77026704 CTGAAAGCCCAGCTGGCAGATGG - Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129911380 15:79229942-79229964 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130706884 15:86241590-86241612 CTGCATACTCACATAGCAGAAGG + Intronic
1131285526 15:91053805-91053827 CTGCAAAGTCACATGGCAGTGGG - Intergenic
1131423916 15:92329916-92329938 CTGTATCCTCATATGGCAAAAGG - Intergenic
1131495183 15:92903277-92903299 ATAAAAACTCTGATGGCAGAAGG - Intronic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1131975289 15:97939759-97939781 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1135843288 16:25895708-25895730 CTGTATACTCACACAGCAGAGGG + Intronic
1136019665 16:27431992-27432014 CTGCATCCTCACATGGCAGAAGG + Intronic
1136385769 16:29925261-29925283 CTGTATACACACATTGCAGAAGG - Intronic
1137912025 16:52387353-52387375 CTGTAAAGAAAGGTGGCAGAGGG + Intergenic
1137916667 16:52439206-52439228 CTGAAGACGCATATGGCAGACGG - Exonic
1138087221 16:54144003-54144025 CTGGGAACTCAGATGACAAAAGG - Intergenic
1138341420 16:56291823-56291845 CTGCATCCTCAGGTGGCAGAAGG + Intronic
1138397160 16:56713860-56713882 CTGTCTCCTCACATGGCAGAAGG + Intronic
1138490299 16:57372609-57372631 CAGGACAGTCAGATGGCAGAAGG - Exonic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1140476559 16:75242084-75242106 ACGTAAACCCAGATGGCACAGGG + Intronic
1140535088 16:75702494-75702516 CTCTAACCTCACGTGGCAGAAGG - Intronic
1140537889 16:75727502-75727524 CTTTAACCTCACATGGCAGAAGG - Intronic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1141191585 16:81828913-81828935 CTGTAAAATCAGAATGCAGTTGG - Intronic
1141225912 16:82114663-82114685 CTGCAAAGTCACATGGCAAAGGG + Intergenic
1143497744 17:7322116-7322138 GTGTAATGGCAGATGGCAGATGG - Intronic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147900753 17:43782326-43782348 CTGTAACCTCACGGGGCAGAAGG + Intronic
1148571059 17:48669471-48669493 CAGTATCCTCACATGGCAGATGG - Intergenic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149344116 17:55717036-55717058 CTGTGCCCTCAGATGGTAGAAGG - Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1150159508 17:62883882-62883904 CTTTAACCTCATATGGCAGAAGG - Intergenic
1150583889 17:66500112-66500134 CTGTGTACTCACATGACAGAAGG - Intronic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150835192 17:68557476-68557498 CTATAACCTGACATGGCAGAAGG - Intronic
1152029542 17:77833467-77833489 CTGCACCCTCACATGGCAGAAGG + Intergenic
1153518528 18:5929406-5929428 CTATAACCTCACATGGCAGAAGG - Intergenic
1153641466 18:7161360-7161382 CTGCATCCTAAGATGGCAGAAGG - Intergenic
1153711049 18:7799205-7799227 CTGCATCCTCACATGGCAGAAGG + Intronic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1154957544 18:21274174-21274196 CTGTATCCTCACATGGTAGAGGG + Intronic
1155619916 18:27767096-27767118 CTCTAACCTCAGATGACAGAAGG + Intergenic
1155694785 18:28672286-28672308 CTGCATCCTCATATGGCAGAAGG + Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1156525748 18:37765836-37765858 CTGTAACCTCACATGGCTGAAGG + Intergenic
1156528169 18:37788042-37788064 CTGTAAACTCAGATCTCTGATGG + Intergenic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156886241 18:42139650-42139672 TTGTATCCTCACATGGCAGAAGG + Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1157281523 18:46349332-46349354 CTGTAACCTTGCATGGCAGATGG + Intronic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158094509 18:53755524-53755546 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158513606 18:58112981-58113003 CTGTATCCTCACATGGTAGAAGG - Intronic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158939845 18:62397361-62397383 CTGTACCCTCACATGGCAGAAGG + Intergenic
1159106346 18:64005518-64005540 CTGTGTACTCACATGGCAGAGGG - Intronic
1160177335 18:76606358-76606380 ATGTATCCTCACATGGCAGAAGG - Intergenic
1160669283 19:349341-349363 CTGAACCCTCACATGGCAGAGGG + Intergenic
1162552893 19:11367687-11367709 CTCTAGTCTCACATGGCAGAAGG + Intergenic
1163381277 19:16970631-16970653 CTGTATCCTCATATGGCAGAAGG - Intronic
1164562587 19:29302978-29303000 CTGAAACCTGAGATGGCATAGGG - Intergenic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1167401284 19:49272187-49272209 CTGTAGAATCACATTGCAGAGGG - Intergenic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925504323 2:4543903-4543925 CTGTAACCTCATATGAAAGAAGG + Intergenic
925603126 2:5629129-5629151 GTGTACACACAGATGGCTGAAGG - Intergenic
925832766 2:7912347-7912369 CTGTAGCCTCACATGGCCGAAGG + Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926583152 2:14654375-14654397 CTCTAACCACAAATGGCAGAAGG + Intergenic
926666299 2:15527536-15527558 CTGTGCCCTCACATGGCAGAAGG + Intronic
926747021 2:16167188-16167210 CAGAAAACTCAGATAGAAGAGGG - Intergenic
926996303 2:18739697-18739719 CTATAATCTCACATGGAAGAAGG - Intergenic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
927601916 2:24450458-24450480 TTGTAACCTCACATGGCAGAAGG - Intergenic
928114309 2:28536009-28536031 CTGTAAAGTCAGGTGGCAGCTGG - Intronic
928280712 2:29943865-29943887 CTGTAACCTTACCTGGCAGAAGG - Intergenic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
929058664 2:37901085-37901107 CTGTAACCTTATATGGCAGAAGG + Intergenic
929129038 2:38547969-38547991 CTGTAACCTCACATGGCAGAAGG - Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929335272 2:40736054-40736076 CTCTAACGTCACATGGCAGAAGG - Intergenic
929584528 2:43105427-43105449 CTCTAACCTCACATGGCAGAAGG - Intergenic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
929985833 2:46731289-46731311 CTGTAACCTCACATGGTGGAAGG - Intronic
930371720 2:50509970-50509992 TTGTATCCTCACATGGCAGAGGG - Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
930831670 2:55750165-55750187 TTGTATCCTCACATGGCAGAAGG - Intergenic
931197301 2:60064587-60064609 CTGTATACTCAGAAGCCAGTAGG + Intergenic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
932667957 2:73711938-73711960 GTGTATCCTCACATGGCAGAAGG - Intergenic
932972298 2:76558908-76558930 CTCTAACCTCACATGGCAGAAGG - Intergenic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933241142 2:79921625-79921647 CTGTACTCTCAAATGCCAGAAGG + Intronic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935936139 2:108185132-108185154 CTGTAACCTCACATGGCAGAAGG + Intergenic
936064309 2:109318997-109319019 CTGTAATCCCAGTTAGCAGAGGG - Intronic
936262974 2:110978245-110978267 TTGTATCCTCACATGGCAGAAGG + Intronic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
936726196 2:115319846-115319868 CTGCATTCTCACATGGCAGAAGG + Intronic
937013600 2:118583548-118583570 CTGCATCCTCACATGGCAGAAGG + Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937237600 2:120440207-120440229 CTCTAAACCCAGCGGGCAGAGGG + Intergenic
937489880 2:122355532-122355554 ATGTTACATCAGATGGCAGATGG + Intergenic
937626480 2:124049898-124049920 CTGTAATCTCACATGGTGGAGGG + Intronic
938051463 2:128176288-128176310 CTGTAAACTCAGCTACCTGAAGG + Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
938912872 2:135901476-135901498 CTGTATCCTCACATGGCAGAAGG - Intergenic
938961485 2:136345504-136345526 CTGCATCCTCACATGGCAGAAGG + Intergenic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939020075 2:136948013-136948035 ATGTAAACTCAGAGTGCTGATGG - Intronic
939455935 2:142435671-142435693 CTATATTCTCACATGGCAGAAGG + Intergenic
939521115 2:143231840-143231862 CTGTATCCTCACATGGCAGAGGG + Intronic
939690771 2:145257646-145257668 CTATAAAGTCACATGGAAGATGG + Intergenic
939770322 2:146308025-146308047 CTGCAAACTCAGGTGAGAGAAGG + Intergenic
939773812 2:146359046-146359068 CTCTAACTTCACATGGCAGAAGG - Intergenic
939839515 2:147170121-147170143 CTGTGTTCTCACATGGCAGAAGG - Intergenic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940372777 2:152921401-152921423 CTGCAACCTCACATGGTAGAAGG + Intergenic
940485795 2:154294086-154294108 CTGTGAGCACAGATGGCTGATGG + Intronic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940669655 2:156651230-156651252 CTGTGTTCTCACATGGCAGAAGG + Intergenic
941282508 2:163570921-163570943 CTATGAACTCATATGGCAGAAGG - Intergenic
941354225 2:164468833-164468855 GTGTCAACTAAGATGGCAGAGGG + Intergenic
941714320 2:168748141-168748163 CTGTACACTCAGATGGCCAATGG + Intronic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
942489624 2:176476399-176476421 CTGTAACCTCACATGGCAGAAGG - Intergenic
942527713 2:176872859-176872881 CTGTAAACTCAGTTATCTGATGG + Intergenic
942996930 2:182274053-182274075 CTGTAACCTCACATGGTAGAAGG + Intronic
943101954 2:183497662-183497684 CTGTGAGCTCACATGGTAGAAGG - Intergenic
943274929 2:185854588-185854610 TTGTATCCTCACATGGCAGAAGG + Intergenic
943280726 2:185929498-185929520 CTGCCACCTCACATGGCAGAGGG - Intergenic
943644819 2:190399051-190399073 CTGCATCCTCACATGGCAGAAGG + Intergenic
943664428 2:190593917-190593939 CTGTTAACTCAGAAGCCAGTGGG + Intergenic
943719486 2:191188916-191188938 CTGTAACCTCACAGGGCAGAAGG + Intergenic
944435491 2:199684696-199684718 GTGTCAAATTAGATGGCAGAGGG + Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
945239406 2:207662393-207662415 CTGTGACCTCACATGGCAGAGGG - Intergenic
945253281 2:207782623-207782645 CTGCAAAGTCCCATGGCAGAGGG - Intergenic
945319506 2:208405846-208405868 TTGCAACCTCACATGGCAGAAGG - Intronic
945657980 2:212648884-212648906 CTGCATCCTCACATGGCAGAAGG + Intergenic
945765385 2:213970057-213970079 CTGTGACCTCACATGGCAGAAGG + Intronic
945852008 2:215019957-215019979 CAATAAACTCAAATGACAGACGG - Intronic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
946202705 2:218080249-218080271 CTTTAAACACAGAAGTCAGACGG - Intronic
946443152 2:219713976-219713998 CTGAGACCTCATATGGCAGAAGG - Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946668089 2:222072404-222072426 GTGGACACTCAGAGGGCAGATGG - Intergenic
946703037 2:222431682-222431704 CTGAGAGCTTAGATGGCAGAGGG + Intronic
946891009 2:224276396-224276418 CTGCATCCTCACATGGCAGAAGG - Intergenic
947082582 2:226415224-226415246 CTGAATCCTCATATGGCAGAAGG - Intergenic
947106085 2:226669158-226669180 CTGCAAAGTCATATGGCAAAGGG + Intergenic
947261110 2:228223501-228223523 CTGTAACCTAACATGGCAGAAGG - Intergenic
947358915 2:229326415-229326437 CTGTAACCTCACATGGCAGTAGG - Intergenic
947385951 2:229590656-229590678 CTGTAACCTCACATGGTAGAAGG - Intronic
947985172 2:234441446-234441468 TAGTAACCTCATATGGCAGAAGG + Intergenic
948326242 2:237123990-237124012 CTGTATTCTCACTTGGCAGATGG - Intergenic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
948654845 2:239470221-239470243 CTGTGTACCCATATGGCAGAAGG - Intergenic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169902478 20:10567410-10567432 CTGTATCCTCACACGGCAGAAGG - Intronic
1169937310 20:10897578-10897600 GTGTAACCACAAATGGCAGATGG - Intergenic
1170489601 20:16859208-16859230 CTGTATTCTAATATGGCAGAGGG + Intergenic
1170532550 20:17309025-17309047 CTGAAAAGTCACATGGCAGAGGG + Intronic
1170962710 20:21039571-21039593 CTGCAAAGTCACATGGCAAAGGG - Intergenic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171571228 20:26253477-26253499 CTGTGCCCTCACATGGCAGAAGG + Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1172938223 20:38636149-38636171 TTGCAAATTCACATGGCAGAGGG + Intronic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173311124 20:41896889-41896911 CTGCAAAGTCATATGGCAAAAGG + Intergenic
1173699290 20:45053623-45053645 CTGTAAGCACAGGTGACAGATGG + Intronic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1174517770 20:51106303-51106325 CTGCATCCTCACATGGCAGAAGG - Intergenic
1174722337 20:52826435-52826457 CTGCATCCTCACATGGCAGAAGG + Intergenic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176887896 21:14277858-14277880 TTGTAGAATCAGCTGGCAGATGG + Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177003968 21:15648032-15648054 CTATATCCTCACATGGCAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177080694 21:16635210-16635232 CTGAAATATCACATGGCAGAAGG - Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177301979 21:19258802-19258824 CTGTAACCTCACATGGCAGAAGG + Intergenic
1178019442 21:28392920-28392942 CTGCAAAGTCACATGGCAAAGGG - Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179194052 21:39149110-39149132 CTGTGTTCTCATATGGCAGAAGG + Intergenic
1179267280 21:39814899-39814921 CTGTGTACTCATATGGCAGCTGG - Intergenic
1180113660 21:45681000-45681022 CTGCATTCTCACATGGCAGAAGG + Intronic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180573405 22:16750497-16750519 CTGTGCCCTCACATGGCAGAAGG + Intergenic
1180942632 22:19669409-19669431 CTGCATCCTCACATGGCAGAAGG - Intergenic
1182018737 22:27063142-27063164 CTGCAAAGTCACATGGCAAAAGG + Intergenic
1182075963 22:27495553-27495575 CTGTCCACTAAGATGACAGAAGG + Intergenic
1182229545 22:28827062-28827084 CCGTAACCTCAAATGGCAAAGGG - Intergenic
1182607610 22:31518675-31518697 CTGGAAACTTAGATTTCAGAAGG + Intronic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182920535 22:34075208-34075230 CTGTATCCTCACATGGCAGAAGG + Intergenic
1183012392 22:34957583-34957605 CTGTAACCTCACATGGCAGAAGG + Intergenic
1183112488 22:35660721-35660743 CTGTGTTCTCACATGGCAGAAGG + Exonic
1183189512 22:36312684-36312706 TTGTAAACTCAGTGTGCAGAAGG - Intronic
1183283598 22:36948324-36948346 CTGTAACCTCATATGGCCGAAGG + Intergenic
1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG + Intronic
1183761352 22:39821825-39821847 CTATAACCTCTCATGGCAGAAGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184304126 22:43583707-43583729 CTGTAACCTCATGTGGCAGAAGG - Intronic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1185044120 22:48520469-48520491 CTGCAGAATCAGATGGCAGTTGG - Intronic
949636257 3:5984641-5984663 CTGTATCATCACATGGCAGAAGG + Intergenic
950167195 3:10810372-10810394 CTGCAAAGTTACATGGCAGATGG + Intergenic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
951626317 3:24667652-24667674 CTGTGTTCTCACATGGCAGAAGG - Intergenic
951706613 3:25550458-25550480 CTGTAACCTCACATGGCAGAAGG + Intronic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952191396 3:31026773-31026795 CTGTAAACTCAAATTAGAGAGGG + Intergenic
952843354 3:37666759-37666781 CTGCAAAGTCACATGGCAAAGGG + Intronic
953437879 3:42894159-42894181 CTGTGTCCTCATATGGCAGAAGG + Intronic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956524070 3:70138412-70138434 CTGTAACCTCACGTGGCAGAAGG + Intergenic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956819567 3:72941380-72941402 ATGTAAACTCAGAATGCAAAGGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957016559 3:75070427-75070449 CTGCATCCTCACATGGCAGAAGG - Intergenic
957180802 3:76875150-76875172 CTATATCCTCACATGGCAGAAGG - Intronic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
957450312 3:80372901-80372923 CTGTAAACTCAGGTTTCTGAAGG - Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958577040 3:95964102-95964124 CTATGCCCTCAGATGGCAGAAGG - Intergenic
958602301 3:96312148-96312170 CTGCATCCTCACATGGCAGAAGG + Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959781822 3:110243086-110243108 CTGTGCCCTCACATGGCAGAAGG + Intergenic
960375196 3:116892316-116892338 CTGTAATTTCACATGGCAGAAGG + Intronic
961902501 3:130226665-130226687 CTGCAACCTCACATGGCAGAAGG + Intergenic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963024884 3:140909844-140909866 CTGTAATCCCAGATGGCTGAGGG - Intergenic
963351472 3:144157352-144157374 CTGTAAAATGAGATGTTAGAAGG + Intergenic
964634339 3:158843730-158843752 CTGAGAACCCAGAGGGCAGATGG - Intergenic
964838469 3:160967478-160967500 CTGTAACCTTACATGGCAGGAGG + Intronic
965797562 3:172457243-172457265 CTGCATCCTCACATGGCAGAAGG + Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966345724 3:178977478-178977500 CTGCAAAGTCACATGGCAAATGG + Intergenic
967248394 3:187512506-187512528 TTGTATCCTCAGGTGGCAGAGGG + Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
968251236 3:197216741-197216763 CTGGAAACTTAGATTTCAGAAGG - Intronic
968312610 3:197696472-197696494 CTTTAATTTTAGATGGCAGAAGG - Intronic
969081367 4:4621173-4621195 CTGTGTTCTCACATGGCAGAAGG + Intergenic
969264856 4:6057696-6057718 CTGCCAAGTCACATGGCAGAGGG - Intronic
969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG + Intronic
969671455 4:8592530-8592552 CAGTGCACTCAGGTGGCAGATGG + Intronic
969778343 4:9376642-9376664 CTGCAACACCAGATGGCAGAAGG - Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970225742 4:13855200-13855222 CTGTATCCTCACATGGCTGAGGG - Intergenic
970675770 4:18448649-18448671 CTGTCACTTCACATGGCAGAAGG - Intergenic
970756508 4:19433273-19433295 CTGTGTTCTCATATGGCAGAAGG + Intergenic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971047182 4:22817790-22817812 CTGTGTCCTCATATGGCAGAAGG - Intergenic
971251233 4:24975086-24975108 CTGCAACCTCACATGGCATAAGG - Intronic
971504046 4:27347412-27347434 TTGTAGACTCATATGGCAGAAGG + Intergenic
971520794 4:27547662-27547684 CTGTGACCTCACATTGCAGAAGG + Intergenic
971599580 4:28575314-28575336 CTCTGAGCTCACATGGCAGAAGG + Intergenic
971842413 4:31871134-31871156 CTGTATTCTTACATGGCAGAAGG - Intergenic
972047314 4:34682820-34682842 CTGTAAACTCAGTTTGCACATGG - Intergenic
972142307 4:35976089-35976111 CTGTGTTCTCACATGGCAGAAGG + Intronic
972176869 4:36419166-36419188 AAGAAAACACAGATGGCAGATGG + Intergenic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972220564 4:36949943-36949965 CTGTGAACTCAGCTGGGAGGAGG - Intergenic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973558504 4:52110143-52110165 CTGTGTCCTCATATGGCAGAGGG - Intergenic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974677515 4:65112576-65112598 ATGTAAAAACAGATGGCTGATGG + Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
974837285 4:67266227-67266249 CTGTGTCCTCAGGTGGCAGAAGG + Intergenic
975241840 4:72068329-72068351 CTGTGTCCTAAGATGGCAGAAGG + Intronic
975740894 4:77427830-77427852 TTGTAGCCTCACATGGCAGAAGG + Intronic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976335265 4:83878311-83878333 ATGTAAAATCAAATTGCAGAGGG + Intergenic
976598699 4:86918066-86918088 CTCTAATGTCACATGGCAGAAGG + Intronic
976639588 4:87323942-87323964 CTGTCACCTCAAGTGGCAGAAGG + Intergenic
977124111 4:93142427-93142449 CTGTCACCTCATATGGCAGACGG + Intronic
977421314 4:96803325-96803347 CTGTAACCTCACATGGCAGAAGG - Intergenic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
978099140 4:104815276-104815298 CTGTGTACTCACATGACAGAAGG - Intergenic
978367934 4:108002122-108002144 CTGTGTCCTCATATGGCAGAAGG - Intronic
978628544 4:110715769-110715791 TTGTCAACTGAGGTGGCAGATGG - Intergenic
978941611 4:114443144-114443166 CTGTCTTCTCACATGGCAGAGGG + Intergenic
978964446 4:114724604-114724626 CTGTGTTCTCACATGGCAGAAGG - Intergenic
979080262 4:116329840-116329862 CTGCATCCTCACATGGCAGAAGG - Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979210387 4:118093961-118093983 CTGTATTTTCACATGGCAGAAGG + Intronic
979773115 4:124554575-124554597 CTGTAACTTCACATGGCATAAGG + Intergenic
980174848 4:129332209-129332231 CTGTAACCTCACATGGCAGAAGG - Intergenic
980492447 4:133545537-133545559 CTGTAACGTCACATAGCAGAAGG + Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981274992 4:142888743-142888765 CTATAACCTCACATGGCAGAAGG - Intergenic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981417134 4:144506353-144506375 CTATATACTCACATGGTAGAAGG + Intergenic
981506690 4:145508820-145508842 CTGTAACCTCATATGGTGGAAGG + Intronic
981874635 4:149527437-149527459 CTGCATCCTCACATGGCAGAAGG - Intergenic
982419393 4:155176859-155176881 CTGTACCTTCACATGGCAGAAGG + Intergenic
982481733 4:155920556-155920578 CTGAAAACTCTGATGCCACAAGG + Intergenic
982796571 4:159653319-159653341 CTGGAAACTCGGCAGGCAGAAGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
982999086 4:162388945-162388967 CTGTGCACTCACATGGCAGGAGG + Intergenic
983278694 4:165652566-165652588 CTATAACCTCACATGGCACACGG - Intergenic
983473548 4:168186526-168186548 TTCTAAGCTCACATGGCAGAAGG - Intronic
983480155 4:168263661-168263683 CTGTGCCCTCACATGGCAGAAGG - Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983667562 4:170198532-170198554 ATGAAACCTCATATGGCAGAAGG + Intergenic
984045731 4:174796187-174796209 CTGTAACCTCACATGGTGGAAGG - Intronic
984077545 4:175202035-175202057 CTGTAAACTCTGTGGGCACAGGG + Intergenic
984183184 4:176510309-176510331 CTGTAAAGTTATATGGTAGAGGG - Intergenic
984435958 4:179710420-179710442 CTGTAACCTCACATGGCAGAAGG + Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
985183465 4:187290822-187290844 CTCTAACTTCACATGGCAGAAGG - Intergenic
985231169 4:187819798-187819820 CTGTATATTCACATGCCAGAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986203552 5:5601329-5601351 CTGTAATCTCCCATGGTAGAAGG + Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
987145841 5:14990724-14990746 CTGTAACCTCACATGGTAGAAGG + Intergenic
987571064 5:19659716-19659738 CTGCATCCTCACATGGCAGAAGG - Intronic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988104152 5:26721954-26721976 CTGTAACCTCACATGGTGGAAGG + Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988368089 5:30328602-30328624 CTGTAACTTCACATGACAGAAGG + Intergenic
988779655 5:34508665-34508687 CTGTAACCTCATATGGCAGAAGG - Intergenic
988802736 5:34711657-34711679 CTGTGTCCTCATATGGCAGAAGG - Intronic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
988832609 5:35002604-35002626 CTGTGACCTCACATTGCAGAAGG - Intronic
988858138 5:35249058-35249080 CTGTGATCTCACATGGCAGAAGG + Intergenic
988881656 5:35509882-35509904 CTGTAATCTTATGTGGCAGAAGG - Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989556602 5:42803845-42803867 AAGTAAACTCAGACTGCAGATGG + Intronic
989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG + Intergenic
989567946 5:42919775-42919797 TTGTCAACTCAGAAGGCACAAGG - Intergenic
989681066 5:44030859-44030881 GTGTGGACTCACATGGCAGAAGG + Intergenic
989703443 5:44298324-44298346 CTGTATCCTCAGATGACAGAAGG - Intergenic
990261393 5:54026856-54026878 ATGTAAACTGAGTTGCCAGAAGG + Intronic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990362236 5:55032234-55032256 CTCTAATCTCACATGGTAGATGG + Intronic
991221529 5:64224907-64224929 CTGCATCCTCACATGGCAGAAGG - Intronic
991274500 5:64828539-64828561 CTGCATCCTCAAATGGCAGAGGG + Intronic
991357512 5:65784527-65784549 CTATATCCTCACATGGCAGAAGG + Intronic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
991532093 5:67626849-67626871 CTGCATTCTCACATGGCAGAAGG - Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992157930 5:73973067-73973089 TTATAACCTCACATGGCAGAAGG + Intergenic
992543484 5:77786705-77786727 CTGTAATCTCAGCAGTCAGATGG + Intronic
992810439 5:80382409-80382431 CTGTGTTCTCACATGGCAGAAGG + Intergenic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993748293 5:91630246-91630268 CTGGATCCTCACATGGCAGAGGG - Intergenic
993860321 5:93128127-93128149 TTTTAAAGTCAGAGGGCAGAAGG - Intergenic
994117550 5:96078084-96078106 CTGTGCCCTCACATGGCAGAGGG + Intergenic
994448105 5:99903598-99903620 CTGTATTCTCATATGGGAGAAGG - Intergenic
994665933 5:102705244-102705266 CTGCATCCTCATATGGCAGAAGG - Intergenic
994759549 5:103835782-103835804 CTGGGCACTCACATGGCAGAAGG - Intergenic
995377746 5:111495388-111495410 CTGTGTCCTCATATGGCAGAAGG + Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
995945112 5:117635627-117635649 GTGTCAACTCAGGTGGAAGAAGG - Intergenic
996263447 5:121503668-121503690 CTTTAAACTCTGTTGGCAGCTGG - Intergenic
997243467 5:132325872-132325894 CAGTAAACTGACATGGCACACGG - Intronic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997446758 5:133945975-133945997 CTGGAAGCTAAGAAGGCAGAGGG - Intergenic
997909393 5:137854970-137854992 CTGTGACCTCACATGGTAGAAGG - Intergenic
997939270 5:138142164-138142186 CTGTATCCTCACATGGCAGAAGG - Intronic
998671457 5:144358780-144358802 CTGCACCCTCAGATGGTAGAAGG + Intronic
998788034 5:145733826-145733848 CTTTTACCTCACATGGCAGAAGG + Intronic
998980966 5:147701732-147701754 CTGCATCCTCACATGGCAGAAGG - Intronic
999078887 5:148825044-148825066 CAGTAAAGTCACATGCCAGATGG + Intergenic
999364696 5:151014558-151014580 CTGTACCCTCACATGGTAGATGG - Intergenic
999461804 5:151763210-151763232 CTGTCCCCTCACATGGCAGAAGG - Intronic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
999892248 5:155991516-155991538 CTCTAAGCTCAGAAGGGAGAAGG + Intronic
999895444 5:156027934-156027956 CTGTATACTCATATGGCAGAAGG + Intronic
1000013605 5:157257446-157257468 CTGTGTTCTCATATGGCAGAAGG - Intergenic
1000363239 5:160467549-160467571 CTGTAAACTGACCTGGCAGGCGG - Intergenic
1000423414 5:161062627-161062649 CTGTGACCTCACATGGCGGAAGG - Intergenic
1000949203 5:167460097-167460119 TTCTAAACTCAGATGTGAGAGGG - Intronic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1001730269 5:173948794-173948816 TTGTACACTCACATGGCAGAAGG + Intronic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1001947237 5:175789845-175789867 CTGTGCCCTCACATGGCAGAAGG - Intergenic
1002165464 5:177341675-177341697 ATGTAAAGTCAGATTCCAGAAGG + Intronic
1002381843 5:178836300-178836322 CTGTAACCTTGCATGGCAGAAGG + Intergenic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1003062038 6:2871246-2871268 CTGGAAACTCATATTGTAGATGG - Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1007038076 6:38696521-38696543 CTGTGACCTCACATGGCAGAAGG + Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1007295918 6:40820395-40820417 CTGCACCCTCACATGGCAGAAGG - Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1007603979 6:43103234-43103256 TTTTAAACTCAGAAGGGAGAAGG - Intronic
1008404467 6:51103346-51103368 CTGTTCACTCTGATGGTAGAGGG - Intergenic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1009547883 6:65045570-65045592 CTGTAACCTGACATGGCAGAAGG - Intronic
1009882816 6:69590605-69590627 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1010473652 6:76261052-76261074 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1010496978 6:76545805-76545827 CTGTAATTTCACATGGCAAAAGG - Intergenic
1010582638 6:77618171-77618193 CTGTATCCTCCCATGGCAGAAGG - Intergenic
1010628307 6:78166581-78166603 CTGTAATCTCACATGAAAGAAGG + Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011494795 6:87927248-87927270 ATGTAAACTCAGATCGCAAAAGG - Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012257663 6:97052290-97052312 CTGTCAACTCAGATACCACAAGG + Intronic
1012448250 6:99328366-99328388 CTGTAACCTCATATGGTGGAAGG - Intronic
1012599619 6:101079070-101079092 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1012874266 6:104707686-104707708 CTGTATCCTCAAATGGTAGAAGG + Intergenic
1013427590 6:110027895-110027917 CTGCATCCTCACATGGCAGAAGG + Intergenic
1013478186 6:110529123-110529145 CTGTAACCTCACAAGGCGGAAGG - Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1014052864 6:116976089-116976111 CTGTAACTTCACATGGCAGAAGG - Intergenic
1014854064 6:126377530-126377552 TACTAAACTCAGATTGCAGAAGG + Intergenic
1015069141 6:129068467-129068489 CTGTAGCCTCACATGGCAGAAGG + Intronic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015342929 6:132122846-132122868 ATGTACACTCAAATGGGAGAAGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1016026691 6:139294579-139294601 CTGCACCCTCACATGGCAGAGGG - Intergenic
1016040976 6:139431700-139431722 CTCTAACCTCACATGGCAGAAGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1016571242 6:145515545-145515567 CTCTAACCTCACATGGTAGAAGG + Intronic
1016587539 6:145706998-145707020 CTGCAGCCTCACATGGCAGAGGG - Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016806858 6:148220258-148220280 CTGTATCCTCATATGGCAGAAGG + Intergenic
1017087282 6:150725177-150725199 GTGTATCCTCACATGGCAGAAGG + Intronic
1017192372 6:151668230-151668252 CTGTGTCCTCATATGGCAGAAGG + Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019902806 7:4036737-4036759 CTGTAATCTCATATGACAGAAGG - Intronic
1021608357 7:22432127-22432149 CTCTAACCTTACATGGCAGAAGG - Intronic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022224198 7:28346351-28346373 CTGTATCCTCACATGGGAGAAGG + Intronic
1022251193 7:28610213-28610235 CTGTTCACCCAGCTGGCAGAGGG - Intronic
1022371102 7:29772395-29772417 CTGTATCCTCACATGGCAGAGGG + Intergenic
1023131207 7:37005235-37005257 CTGTAAATTCAGCGGGTAGAGGG + Intronic
1023305619 7:38823285-38823307 TTGTAACTTCACATGGCAGAAGG - Intronic
1023385001 7:39647735-39647757 CTGTAACCTCACATGGTGGAAGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024132021 7:46362773-46362795 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1024132071 7:46363231-46363253 CTGCATCCTCATATGGCAGAAGG + Intergenic
1024298996 7:47871436-47871458 CTGTGACCTCACATGACAGAAGG + Intronic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024522252 7:50315683-50315705 CTGTAAAGGGAGATGCCAGAAGG - Intronic
1024595116 7:50926337-50926359 CTATATACTCACATGGCAGGAGG + Intergenic
1024716333 7:52083440-52083462 CTGCATCCTCACATGGCAGAAGG + Intergenic
1024755281 7:52522147-52522169 CTGTGACCTCACATGGCAAAGGG + Intergenic
1025121481 7:56307644-56307666 CTATGTACTCACATGGCAGAAGG - Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1026818542 7:73531024-73531046 CTGTATCTTCACATGGCAGAAGG + Intergenic
1027569650 7:79847994-79848016 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1027962998 7:84970504-84970526 CTATAAACTAACATGGCAAAGGG - Intergenic
1028299809 7:89183806-89183828 CTGTATATTCAAATGCCAGAAGG - Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028776839 7:94687284-94687306 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1028871761 7:95778176-95778198 CTTTAACCTTATATGGCAGAAGG + Intronic
1028879236 7:95860785-95860807 CTGTATCCTCACATGGCAGAAGG + Intronic
1029003487 7:97182082-97182104 CTGTATCCTCATATGGTAGAAGG - Intergenic
1029188149 7:98754193-98754215 CGGTAAACTGACATGGCACAGGG + Intergenic
1029847103 7:103423622-103423644 CTGTATCCTCACATGGCGGAAGG - Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1031058865 7:117026684-117026706 CTGTAAGCTTAGATGGTAGATGG - Intronic
1031161919 7:118179057-118179079 CTGCATCCTCACATGGCAGAAGG - Intergenic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031265691 7:119577370-119577392 CAGGAAACTTATATGGCAGAAGG + Intergenic
1031285650 7:119863894-119863916 CTGTAACCTCACATGGCAGAAGG - Intergenic
1031570613 7:123354849-123354871 CTGTAACCTCACATGGTAGAAGG + Intergenic
1031677594 7:124630605-124630627 CTGCAAATTAAGATGACAGATGG + Intergenic
1031788819 7:126072956-126072978 CTGTGAGCTCATATGGCACAAGG + Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1031998959 7:128252345-128252367 CTGGAATCTCAGCAGGCAGAGGG - Intronic
1032608263 7:133382305-133382327 CTGGAAACTAGGCTGGCAGATGG - Intronic
1033819858 7:145122277-145122299 CTGAAAAGTCTGATGCCAGATGG + Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1035892875 8:3364714-3364736 CTGTGACATCACATGGCAGAAGG - Intronic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036275799 8:7350638-7350660 CTGAAACACCAGATGGCAGAAGG - Intergenic
1036345556 8:7959720-7959742 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036542326 8:9729113-9729135 CTGTATCCTCACTTGGCAGAAGG + Intronic
1036566869 8:9945342-9945364 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1036840883 8:12120474-12120496 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036862690 8:12366724-12366746 CTGAAACACCAGATGGCAGAAGG + Intergenic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038348040 8:26750151-26750173 CTGGAACCTCAGATAGCAGAAGG + Intronic
1038394307 8:27235778-27235800 CTGCATCCTCACATGGCAGAAGG - Exonic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1038680434 8:29662502-29662524 CTGTGACCTCACATGGTAGAAGG + Intergenic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1039630172 8:39102450-39102472 CTACAAACTCACAGGGCAGAGGG + Intronic
1039673767 8:39635094-39635116 CTGTATCCTCACATGGCAGAAGG - Intronic
1039806758 8:41006522-41006544 CTGTAATCTCACGTGGTAGAAGG - Intergenic
1040830834 8:51675339-51675361 CTGTATCCTCAGGTTGCAGAAGG - Intronic
1040946276 8:52888030-52888052 CTGCATCCTCATATGGCAGAGGG - Intergenic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041422891 8:57689346-57689368 CTGCATCCTCACATGGCAGAAGG + Intergenic
1041816624 8:61980213-61980235 CTGTGACCTCAGATGTCAGCCGG + Intergenic
1041862407 8:62529557-62529579 CTGTAAGCTCATATGGTGGAAGG - Intronic
1041940615 8:63383024-63383046 CTGTATTCTCATATGGTAGAAGG - Intergenic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042640370 8:70927582-70927604 CTATGACCTCACATGGCAGAAGG + Intergenic
1042686448 8:71446405-71446427 CAGGAAACTTACATGGCAGAAGG - Intronic
1042936653 8:74066196-74066218 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1042990278 8:74631817-74631839 CTGCATCCTCACATGGCAGAAGG + Intronic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1043611736 8:82072585-82072607 CTATATACTCAGAAGGCAAAGGG - Intergenic
1044273393 8:90272841-90272863 CTCTGAAGTCAGATGGCACAAGG - Intergenic
1044388940 8:91625882-91625904 CTGTCAACTTAGTTGGCATATGG + Intergenic
1044400023 8:91759596-91759618 CTGTAACATCACATGGCAGATGG - Intergenic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1045914252 8:107447375-107447397 CTAGAAATTCACATGGCAGAAGG - Intronic
1045998774 8:108395211-108395233 CAGGAAACTTACATGGCAGAAGG + Intronic
1046616294 8:116481180-116481202 CTGTATCCTCACATGGTAGAAGG + Intergenic
1046637226 8:116683388-116683410 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1046748219 8:117898399-117898421 CTGCAAACTCAGTGGACAGAAGG + Intronic
1046865857 8:119149658-119149680 CTGTATACTCATATGACAGAAGG - Intergenic
1047014642 8:120710660-120710682 CTGTGTTCTCACATGGCAGAAGG - Intronic
1047028562 8:120851215-120851237 CTGTATCCTCACATGGTAGAAGG - Intergenic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047636923 8:126773929-126773951 CTGTATCCTCACATGGCAGAAGG + Intergenic
1048035368 8:130672777-130672799 CTGAAATCTATGATGGCAGAAGG + Intergenic
1048308986 8:133303712-133303734 CTATAATCTCACAAGGCAGAAGG - Intergenic
1048505658 8:135018803-135018825 CAGAAAACTAAGATGGCAGGTGG - Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1049111099 8:140643989-140644011 CTGTATCCTCATATGGTAGAAGG - Intergenic
1049459341 8:142716488-142716510 CTGCAAAGTTACATGGCAGAGGG - Intergenic
1050017180 9:1246325-1246347 CTATAACCTCATATGGCAGAAGG - Intergenic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1050242920 9:3657915-3657937 CTGGAAACAGAGATGCCAGATGG + Intergenic
1050844463 9:10196904-10196926 CTGTAACCTCACTTAGCAGAAGG - Intronic
1051021685 9:12552581-12552603 CTGTAACCTTAAATGGAAGAAGG + Intergenic
1051038149 9:12774975-12774997 CTTTAAACTCCGCTGGCAGGTGG - Intergenic
1051922881 9:22288307-22288329 CTGTATCATCACATGGCAGAAGG + Intergenic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052338911 9:27346135-27346157 CTGCATTCTCACATGGCAGAAGG - Intronic
1052915039 9:33918689-33918711 ATGTAAAATCAGATTTCAGAAGG + Exonic
1053375308 9:37601036-37601058 CTGTATCCTCACATGACAGAAGG + Intronic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054704534 9:68449086-68449108 CTGTATCCTCATGTGGCAGAAGG + Intronic
1055167145 9:73210814-73210836 CTGTAACATAACATGGCAGAAGG + Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1055685174 9:78765788-78765810 GTGCAAACTCACATGGCAAAGGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056335326 9:85562976-85562998 CTGTAACCTCATATGGCAGAAGG - Intronic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057562708 9:96140654-96140676 CTGTAAACACTGACGGCAGTCGG - Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1058032233 9:100213040-100213062 CTGTATCCTCACATGACAGAAGG + Intronic
1058140666 9:101354293-101354315 CTGCATCCTCACATGGCAGAAGG + Intergenic
1058765344 9:108177359-108177381 CTGTGTTCTCATATGGCAGAAGG + Intergenic
1059470003 9:114497803-114497825 CTTTACACTCAAATAGCAGAGGG + Intronic
1059712035 9:116877551-116877573 CAGTAAGATCATATGGCAGAGGG + Intronic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1060011602 9:120048336-120048358 CTGTGCTCTCACATGGCAGAAGG - Intergenic
1060034419 9:120242643-120242665 TTTTAAAATGAGATGGCAGATGG - Intergenic
1060883887 9:127137163-127137185 CTCTACAATCAGGTGGCAGATGG - Intronic
1061421588 9:130475691-130475713 CTGAGAACTCAGACTGCAGATGG + Intronic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1062406500 9:136399376-136399398 CTGTAAACTCAGTTAACAGCCGG + Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186273651 X:7917297-7917319 CTGTAAAATCAGATGCCTAAAGG + Intronic
1186429179 X:9489767-9489789 CTGAAAAGTCACATGGCAAAGGG + Intronic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186695212 X:12023142-12023164 CTGTAACCTCATATGGTAGAAGG - Intergenic
1186709466 X:12178146-12178168 CTGTATCCTCAAATGGCAGAAGG - Intronic
1187056780 X:15748163-15748185 CTGTACACTTAGCTGGCAAAGGG + Intronic
1187083076 X:16011520-16011542 CTTTAAAATAAGATGACAGAAGG - Intergenic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187609375 X:20924602-20924624 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1188159910 X:26786420-26786442 CTGTAACCTCAGATCTCTGATGG - Intergenic
1188293511 X:28417564-28417586 CTGCATCCTCACATGGCAGAAGG + Intergenic
1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG + Intergenic
1188606832 X:32041482-32041504 ATGTTAACTCAGAAAGCAGAAGG - Intronic
1188622243 X:32240398-32240420 CTGTAACCTCACAAGGCAGCAGG - Intronic
1189061443 X:37757547-37757569 CTGTAAAGTCACATAGCAAAGGG - Intronic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189366864 X:40395531-40395553 CTGTGACCTCACACGGCAGAGGG + Intergenic
1189556263 X:42148452-42148474 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189774484 X:44458151-44458173 CTGTATACTTACATGGCAGAAGG + Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190211782 X:48454565-48454587 CTGCATTCTCATATGGCAGAAGG - Intergenic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1192032423 X:67528482-67528504 CTGTGGTCTCATATGGCAGAAGG + Intergenic
1192285156 X:69727475-69727497 CTGTGTTCTCACATGGCAGAAGG + Intronic
1192374174 X:70542251-70542273 CTGTAAGCTCACATGGCAGAAGG - Intronic
1192816559 X:74599610-74599632 CTTTAACCTCACATGGCAAAAGG - Intronic
1193668459 X:84353431-84353453 CTGTAACCTCTCATGGCAGAAGG - Intronic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194020449 X:88684043-88684065 CTGCAATCTCACATGGAAGAAGG + Intergenic
1194764391 X:97832533-97832555 CTGTGACTTCACATGGCAGAAGG + Intergenic
1194779623 X:98009176-98009198 CTGTATTCTCCCATGGCAGAAGG + Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195139569 X:101945654-101945676 CTGTACCCTCACATGCCAGAAGG - Intergenic
1195196701 X:102503942-102503964 CTACAAACTCACATGGCAGAAGG + Intergenic
1195265918 X:103179636-103179658 CTGTATGCTTACATGGCAGAAGG + Intergenic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1195430324 X:104781985-104782007 CTGTATCCTCACATGGCAGAAGG - Intronic
1196321374 X:114344392-114344414 CTGTTTTCTCACATGGCAGAAGG - Intergenic
1196972807 X:121127998-121128020 CTGTATCCTCACATAGCAGAAGG + Intergenic
1197883065 X:131189641-131189663 CTGCATACTAACATGGCAGAAGG - Intergenic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198574044 X:137990599-137990621 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1199053038 X:143259827-143259849 CTGGAAACTCAAAAAGCAGATGG + Intergenic
1199279840 X:145988421-145988443 CTGTAACTTCACATGGCAGAAGG - Intergenic
1199340225 X:146668973-146668995 TTGTAACCTCACATTGCAGAAGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199747325 X:150781531-150781553 TTGTGAACTCAGAAGGCAGGTGG - Intronic
1199751736 X:150826107-150826129 CTGTGTTCTCACATGGCAGAAGG - Intronic
1199778215 X:151034214-151034236 CTGCATTCTCACATGGCAGAAGG - Intergenic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1202042533 Y:20700002-20700024 CTGTACACTCAAATTGCAGTTGG + Intergenic