ID: 1041036903

View in Genome Browser
Species Human (GRCh38)
Location 8:53801385-53801407
Sequence TTGCAGGTATAGAAACTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041036903_1041036906 -1 Left 1041036903 8:53801385-53801407 CCTCAAAGTTTCTATACCTGCAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1041036906 8:53801407-53801429 AATTAGGATCCCACAAAGATTGG No data
1041036903_1041036907 0 Left 1041036903 8:53801385-53801407 CCTCAAAGTTTCTATACCTGCAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1041036907 8:53801408-53801430 ATTAGGATCCCACAAAGATTGGG No data
1041036903_1041036911 28 Left 1041036903 8:53801385-53801407 CCTCAAAGTTTCTATACCTGCAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1041036911 8:53801436-53801458 TTATATGGCATTAGAAAGAAAGG No data
1041036903_1041036910 13 Left 1041036903 8:53801385-53801407 CCTCAAAGTTTCTATACCTGCAA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1041036910 8:53801421-53801443 AAAGATTGGGCTAAATTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041036903 Original CRISPR TTGCAGGTATAGAAACTTTG AGG (reversed) Intronic
901572768 1:10175020-10175042 TTGCAGGTAAAGAAACTGAGAGG + Intronic
911908271 1:103596849-103596871 TTGCAGGTGTATAAACTTACAGG - Intergenic
911914647 1:103682617-103682639 TTGCAGGTGTATAAACTTACAGG + Intronic
914936551 1:151986374-151986396 TTTCAGGTATATATACATTGTGG + Intronic
915699639 1:157779392-157779414 TGGAAGCTATAGAAATTTTGTGG + Intergenic
918266621 1:182848105-182848127 CTTCAGGTATAGAAGTTTTGAGG - Intronic
919348285 1:196415627-196415649 TTGGAGAGACAGAAACTTTGAGG - Intronic
919964212 1:202505068-202505090 TTGGAGTTATAGAAGATTTGGGG - Intronic
920370473 1:205475893-205475915 TTTCAGGTATAGATACCTAGTGG - Intergenic
921008645 1:211118499-211118521 TTGCAGCTATAGACCCTTAGGGG - Intronic
922070949 1:222193025-222193047 TTGTAGGAATAGAGAATTTGGGG - Intergenic
924854599 1:247863670-247863692 TGGGAGGTATAGATACTTTGAGG + Intronic
1064766051 10:18673018-18673040 TTTCAGTTATTGAAACTTTTGGG - Intronic
1065495110 10:26319572-26319594 TTGAAGGTAGAGAAAAGTTGAGG + Intergenic
1071423061 10:85521172-85521194 TTGAAGGTAGAGAAAAATTGAGG - Intergenic
1071980109 10:90996887-90996909 TTGCTGGTATAAACACTTTTGGG + Intergenic
1072356733 10:94618890-94618912 CTGCAGTCATAGAGACTTTGGGG - Intergenic
1075102759 10:119517827-119517849 CTGCAGGTATATAAGCTTTGAGG + Intronic
1078461732 11:11519844-11519866 TAGCAGGTATATAAAGTCTGTGG + Intronic
1078615609 11:12862654-12862676 TTGCAGGTCATGAAATTTTGAGG + Intronic
1079737229 11:24012512-24012534 ATACAGGTTTAGAAAATTTGGGG + Intergenic
1079948413 11:26771282-26771304 GTGCAGCTATAGAGACTTGGAGG + Intergenic
1080120051 11:28666801-28666823 TTGCAGGAAGAGAAACCGTGGGG + Intergenic
1080896111 11:36449929-36449951 TAGCAGGTATGGAAGGTTTGGGG + Intronic
1081187108 11:40057360-40057382 TCCCAGGTATGGAAACTTGGTGG - Intergenic
1081645359 11:44786388-44786410 CTGCAGGGAAAGAAACTCTGTGG + Intronic
1085104788 11:73832724-73832746 TTGCTGGTCTAGAAACTGTAGGG + Intronic
1085945018 11:81259022-81259044 ATGCTAGTAGAGAAACTTTGAGG + Intergenic
1086882526 11:92166117-92166139 TTGTAGGTATTTAAACTTGGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089051765 11:115551765-115551787 TGGCAGGATTAGAAAATTTGGGG + Intergenic
1090181125 11:124700722-124700744 TTTGAGGTATAGAAACTATTGGG - Intergenic
1091216434 11:133905126-133905148 TTGCATGTAAAGGAGCTTTGGGG - Intergenic
1091995783 12:4992794-4992816 ATGCAGGAGTAGAAACGTTGGGG + Intergenic
1095119680 12:38402590-38402612 TAGTAGGTGTAGATACTTTGGGG + Intergenic
1097199330 12:57264937-57264959 CTGCAGTTAAAGAAACTTTAGGG - Intronic
1097524429 12:60712565-60712587 CTGCAGGTCTAGAAATTCTGAGG - Intergenic
1098657752 12:73054644-73054666 TTCCAGTTATAGAAACTGTGGGG - Intergenic
1099580288 12:84437381-84437403 TTTCAGGTATACTAACTTTAGGG - Intergenic
1101084404 12:101220972-101220994 TTACAGTTTTAGAAATTTTGGGG - Intergenic
1101198772 12:102413006-102413028 TTGCAGGTCTGGAAGTTTTGTGG + Intronic
1105640717 13:22261092-22261114 TTGCAGCGAGAGCAACTTTGAGG + Intergenic
1106120551 13:26856688-26856710 TTTCAGGTATAGAATGTTTGAGG + Intergenic
1106819378 13:33446249-33446271 TTGCAGAAATAGAAAGTTTTGGG - Intergenic
1106887921 13:34210022-34210044 GTACAGGGATAGGAACTTTGGGG + Intergenic
1107235709 13:38167440-38167462 TTGCTGGTTTAGTAACATTGTGG - Intergenic
1110676327 13:78250194-78250216 TTGTGGGTTTAGAAACTTTCGGG - Intergenic
1110797334 13:79655108-79655130 TTTCAAGTAAAGAAAATTTGAGG - Intergenic
1111239314 13:85454458-85454480 TTGCATGAATAGTAAATTTGAGG + Intergenic
1116442338 14:44967367-44967389 TTGCTGGTCTAGCAATTTTGTGG - Intronic
1117106708 14:52404791-52404813 TAGCAGATATAGAGACCTTGAGG - Intergenic
1119134258 14:72202645-72202667 TTGAAGGCAAAGACACTTTGGGG - Intronic
1120096108 14:80389770-80389792 TGGCTGGTATACCAACTTTGAGG - Intergenic
1120831086 14:88997929-88997951 TTGCAGATAAAGAAACTGAGAGG + Intergenic
1127211418 15:56778558-56778580 TGGCAGGTGTAGCAATTTTGAGG + Intronic
1127737144 15:61852381-61852403 TTACAGGTGTGAAAACTTTGTGG - Exonic
1128015351 15:64340219-64340241 TTGCAGATATAGTTACTTTGTGG - Intronic
1129304567 15:74649949-74649971 TTGGAGGTATTGAACCTGTGAGG - Intronic
1134901456 16:17941701-17941723 TTTCAGTTAAAGAAACTTTTTGG + Intergenic
1139539318 16:67602491-67602513 TTGCAGGGATACTAACTTTTGGG + Intronic
1141283494 16:82650094-82650116 TTGCAGGTAGAGCAATGTTGAGG - Intronic
1142910455 17:3085421-3085443 TATCAGTTATAGAAACTTTTTGG + Intergenic
1143935059 17:10475307-10475329 TTCCAGGTAGGGAAAATTTGGGG + Intergenic
1145118693 17:20236073-20236095 TTGGAGGTATAGATTCTTTAAGG + Intronic
1149134688 17:53350452-53350474 TTGTAGGTATAGAGAGGTTGGGG + Intergenic
1149951950 17:60997494-60997516 GTGCAGGTATTGGAGCTTTGAGG + Intronic
1151152572 17:72100437-72100459 TTTCAGGTACAGAAAGTTGGGGG + Intergenic
1152500503 17:80705414-80705436 TTGCAGGTACAAAAATTTGGGGG + Intronic
1157080074 18:44514940-44514962 TGGCAGGTAGAGGAACTATGAGG - Intergenic
1157806528 18:50662317-50662339 TTACAGGTATAGGAACTAAGTGG - Intronic
1159159762 18:64628936-64628958 CTGCAGATTTAGAAACTTTAGGG + Intergenic
1159820603 18:73137694-73137716 TTGCTGAGATAGACACTTTGAGG + Intergenic
1159854935 18:73574783-73574805 TTTCAAGTATACATACTTTGTGG + Intergenic
1164689383 19:30198804-30198826 TTTCAAGTAGAGAAACTTGGAGG + Intergenic
1167120093 19:47511720-47511742 GTGGAGGTAGAGAAACTTGGGGG - Intronic
925994377 2:9280049-9280071 TTGCAGGGCTAGGAACTGTGAGG + Intronic
927358093 2:22197774-22197796 TTGGAAGTATAAATACTTTGAGG - Intergenic
929089402 2:38199946-38199968 TTGCAGGTAAAGAACCTATAAGG - Intergenic
929766686 2:44849532-44849554 TTATAGTTATGGAAACTTTGGGG + Intergenic
930974570 2:57442308-57442330 TTGCTGGAATAGAAAATTTTTGG + Intergenic
931510686 2:62989467-62989489 TTTCAGCTGTAGCAACTTTGGGG + Intronic
931853536 2:66277970-66277992 TTCCAGTAATAGAAGCTTTGTGG + Intergenic
935099728 2:99982026-99982048 GTGCAGGAATAGCAGCTTTGAGG - Intronic
936853041 2:116924622-116924644 TTGCAGAAATAGAAAGTTAGGGG - Intergenic
938638421 2:133253606-133253628 TTCCAGTTGTAGAAACTCTGGGG + Intronic
939327069 2:140705972-140705994 TTGCACCTTGAGAAACTTTGGGG + Intronic
942051858 2:172147513-172147535 TTGAAGGTATAGAAAGAATGGGG + Intergenic
946113321 2:217439043-217439065 ATACAGGAACAGAAACTTTGTGG - Intronic
946850955 2:223906818-223906840 TTACATCTATAGAAAGTTTGGGG - Intronic
948647211 2:239413056-239413078 GAGCAGGTATAGAAACATTGTGG + Intergenic
1169907804 20:10620873-10620895 TTGCAGATAGAGAAAATATGGGG + Intronic
1170132235 20:13032941-13032963 TTACAAATATGGAAACTTTGAGG - Intronic
1170850732 20:20002191-20002213 TTGCAGGTGCACAAACTATGAGG + Exonic
1171502518 20:25604705-25604727 TGGCAGGTATTTAAATTTTGAGG - Intergenic
1173269635 20:41521001-41521023 TTGCAGGTAGATAGACATTGTGG - Intronic
1174872585 20:54196945-54196967 TATAAGGTATAGAAACTTAGAGG + Intergenic
1179391035 21:40991275-40991297 TTGATGCTATAGAAAATTTGGGG - Intergenic
949585793 3:5435523-5435545 TTGCAGAAACATAAACTTTGGGG + Intergenic
950459251 3:13111470-13111492 TTGCAGGTACAGACTCTTGGAGG - Intergenic
950567018 3:13775559-13775581 TTGGCGGTATGGTAACTTTGTGG - Intergenic
951278148 3:20714666-20714688 TTTTAGGTATAGAAAACTTGGGG + Intergenic
952483064 3:33781624-33781646 TGGCAGGAATAGAAACTCTATGG - Intergenic
955160484 3:56460804-56460826 TTTCAAGTATAGAATCTCTGTGG - Intronic
956759306 3:72424440-72424462 TTGCAGATATAGATACATTTGGG - Intronic
957094212 3:75763191-75763213 TTTGAGGTATAGAAACTTTTAGG - Intronic
957579886 3:82058167-82058189 ATTAAGGTTTAGAAACTTTGAGG + Intergenic
958946212 3:100364993-100365015 CTGCAGTTTTAGAAACTTGGTGG - Exonic
963654582 3:148029548-148029570 ATGCAAATATAGTAACTTTGGGG + Intergenic
963986771 3:151605287-151605309 TTGCAAATATAGAATCTGTGGGG + Intergenic
970381951 4:15517425-15517447 TTGCAAGGATAGAAACTCTCCGG - Intronic
971263355 4:25076690-25076712 TTGCAGTTCTTGCAACTTTGAGG + Intergenic
973742588 4:53932859-53932881 TGGCAGATGCAGAAACTTTGTGG - Intronic
974441525 4:61924515-61924537 TTACAGATATGGAAAGTTTGAGG - Intronic
975179930 4:71333284-71333306 TTGCAGGTTTACCACCTTTGTGG + Intronic
978334622 4:107652353-107652375 TTGCAGGTATAGAAAGAGTATGG + Intronic
979626388 4:122849671-122849693 TTTAAGGTATAGGAACATTGAGG + Intronic
980027445 4:127782843-127782865 TTGAAGGAAAAGAAGCTTTGCGG - Intronic
981585381 4:146295861-146295883 TTGCAGAGAGAGAAATTTTGTGG - Intronic
982716348 4:158812536-158812558 TTTAAGATATAGAAACTTTCAGG - Intronic
984465710 4:180098539-180098561 TATCAGATATAGGAACTTTGGGG + Intergenic
986641583 5:9876970-9876992 TGGCATGTGTAGACACTTTGGGG - Intergenic
987732369 5:21791357-21791379 TTAAAGGCATAGAAATTTTGAGG + Intronic
988140393 5:27231887-27231909 TGGCAGGTATAAAATATTTGGGG - Intergenic
988320273 5:29685930-29685952 TTGGAGGAATAGAAACATTCAGG + Intergenic
989981580 5:50652258-50652280 TGGCAGGTCTGGAAACCTTGGGG + Intergenic
990595294 5:57307073-57307095 TTGCAGGGCTTGAGACTTTGTGG + Intergenic
994364691 5:98899820-98899842 TTGGGGGTATAGAAACTTATGGG + Intronic
994514074 5:100748035-100748057 TTGTAGTAATAGAAATTTTGGGG - Intergenic
994530548 5:100964652-100964674 TTGAAAGTATATAAACATTGTGG - Intergenic
995035102 5:107524819-107524841 TTGCAATTTTAGAAACTTTCTGG + Intronic
1003112691 6:3262665-3262687 TTAGAGGTACAGAGACTTTGGGG - Intronic
1003837493 6:10087442-10087464 TTCCAGGAATAGAAACTTTCTGG + Intronic
1006110014 6:31738815-31738837 ATGGAGCTATAGAAACTTGGAGG - Intronic
1009885025 6:69615745-69615767 TTAAAGGAATACAAACTTTGGGG - Intergenic
1010915978 6:81619406-81619428 TTTCAGGTAATGAAACTTTCTGG - Intronic
1011030106 6:82913238-82913260 GTACAGTGATAGAAACTTTGTGG - Intronic
1011189006 6:84711410-84711432 TTGCAGATACAGTATCTTTGAGG - Intronic
1011839591 6:91479783-91479805 ATTCAGGTATAGAAACTCTATGG - Intergenic
1012847520 6:104409524-104409546 TTGCTGCTATAGAACCTCTGGGG + Intergenic
1013973922 6:116054914-116054936 TTATAGGTATAGAAACAATGTGG - Intronic
1018501562 6:164416229-164416251 TTCAAGGTCTCGAAACTTTGAGG - Intergenic
1022894265 7:34733741-34733763 TTGCATTTATAGAATCTGTGTGG + Intronic
1023059581 7:36314941-36314963 TTTCAGGTAAAGAAACTGAGAGG - Intergenic
1025238245 7:57249651-57249673 TTTCAAGTATACAAACTCTGGGG - Intergenic
1027459441 7:78434739-78434761 TTGGAGATATAGAAAAATTGGGG + Intronic
1027998394 7:85457624-85457646 TTGCACATATAGAAAACTTGGGG + Intergenic
1029009729 7:97246338-97246360 TTGCATTTATAGAAAATTTGGGG - Intergenic
1033029162 7:137808214-137808236 TTGCTGGTATATAAACTATCTGG + Intronic
1034053607 7:148010792-148010814 TTGCATGTATAAAAACTTGATGG - Intronic
1034260165 7:149750266-149750288 TTGCAGGTACAGTTACCTTGTGG - Intergenic
1034917896 7:155056153-155056175 TTGCAGGTATGGCCACGTTGTGG - Intergenic
1041036903 8:53801385-53801407 TTGCAGGTATAGAAACTTTGAGG - Intronic
1041954557 8:63543104-63543126 TTGCTGGTATAGAAGGTGTGGGG + Intergenic
1042306272 8:67336757-67336779 TTCCTGGAATAGGAACTTTGTGG - Intronic
1042313374 8:67400355-67400377 TTGGAGGGATAGAAACATTCTGG - Intergenic
1047573720 8:126130507-126130529 TTGCAGATATAGTAAATTTAAGG + Intergenic
1048732867 8:137463069-137463091 GTCCACTTATAGAAACTTTGAGG - Intergenic
1050696181 9:8281907-8281929 TGGCAGGTGTAGAGACTGTGAGG - Intergenic
1051759627 9:20447772-20447794 TATCAGTTATAGAAACTTTTGGG - Intronic
1052311516 9:27074166-27074188 TTTTTGGTATTGAAACTTTGGGG + Intergenic
1052609423 9:30752956-30752978 ATGAAGTTATAGAAACTCTGGGG + Intergenic
1055404345 9:75958993-75959015 TGGCAGAAATAGAAACTTAGGGG + Intronic
1056467432 9:86871438-86871460 TTGAAGGTAGAGAGAGTTTGTGG - Intergenic
1057808928 9:98242522-98242544 TTGAAGGGATGGAAACTTTCAGG - Intronic
1058051784 9:100413614-100413636 TTTCAAGTACAGAAAATTTGAGG + Intergenic
1061593837 9:131615857-131615879 TTGTAGGCATAGAAACCTTGTGG - Intronic
1191009664 X:55747449-55747471 GGGCAGTCATAGAAACTTTGTGG + Intronic
1193216646 X:78872347-78872369 TTTCAGCTTTAGAATCTTTGGGG + Intergenic
1193435155 X:81465813-81465835 TTTCAGGCAAAGAAAATTTGAGG - Intergenic
1194257321 X:91650913-91650935 TTCCAGACAAAGAAACTTTGAGG - Intergenic
1195097262 X:101515042-101515064 TTGCAGACATAGAAACTTCCAGG + Intronic
1195244970 X:102987293-102987315 TGGCAGTTACATAAACTTTGGGG + Intergenic
1196276421 X:113770841-113770863 TTCCAGATATAGAAAGTTTTAGG + Intergenic
1200343030 X:155419471-155419493 TTGCAGATACAGCTACTTTGGGG - Intergenic
1200575979 Y:4889866-4889888 TTCCAGACAAAGAAACTTTGAGG - Intergenic