ID: 1041038863

View in Genome Browser
Species Human (GRCh38)
Location 8:53825511-53825533
Sequence TTTAATGATAGAGGATCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041038863_1041038869 7 Left 1041038863 8:53825511-53825533 CCATAAGATCCTCTATCATTAAA 0: 1
1: 0
2: 2
3: 10
4: 174
Right 1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG No data
1041038863_1041038868 -9 Left 1041038863 8:53825511-53825533 CCATAAGATCCTCTATCATTAAA 0: 1
1: 0
2: 2
3: 10
4: 174
Right 1041038868 8:53825525-53825547 ATCATTAAACTGGGTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041038863 Original CRISPR TTTAATGATAGAGGATCTTA TGG (reversed) Intronic
901649157 1:10733491-10733513 TTAAATGCTAGAGGCTCTTCAGG + Intronic
904953989 1:34267754-34267776 TTTAGTGATGGGGGAGCTTAGGG - Intergenic
905540797 1:38758890-38758912 ATTTATGCAAGAGGATCTTACGG + Intergenic
905608743 1:39329557-39329579 CTTATTGATAGAGGATCTTGTGG - Intronic
906019779 1:42617567-42617589 TTTGATGATAGGGGTTTTTAAGG + Intronic
906851058 1:49250987-49251009 CTTAGTGATAAAGTATCTTATGG - Intronic
907330956 1:53671255-53671277 TTAAAGGATAGAGGATTTGAAGG + Intronic
907940531 1:59083128-59083150 TTTAATAATTGAGGTTCTTCTGG - Intergenic
908784653 1:67722935-67722957 TTTACAGATAGAGAATCTGAGGG - Intronic
909203122 1:72717635-72717657 TAAAATGATATAGGAGCTTAAGG - Intergenic
912717757 1:111994023-111994045 TTTATTGATAGAGAACCTGAAGG + Intergenic
913205864 1:116538172-116538194 TTTAATTAAAGAAAATCTTAAGG - Intronic
913612835 1:120524932-120524954 TTTAATTAAAGCAGATCTTATGG + Intergenic
914578354 1:148997315-148997337 TTTAATTAAAGCAGATCTTATGG - Intronic
917179183 1:172275768-172275790 TTTAATAATAGATGATGTTACGG - Intronic
918177797 1:182060661-182060683 TTTCAGCATAGTGGATCTTAGGG + Intronic
919597830 1:199586514-199586536 TCTTATGAAAAAGGATCTTATGG - Intergenic
921596602 1:217061031-217061053 TATAATCATAAGGGATCTTATGG + Intronic
922027157 1:221760913-221760935 TTTAAGGAAAGAGAATTTTAGGG + Intergenic
1063767780 10:9161812-9161834 TTTATTGATAGAGGTTATTTTGG - Intergenic
1063813554 10:9743580-9743602 TTTAATGATAGACAATTTTAAGG + Intergenic
1064038991 10:11941545-11941567 TTTAAAGGTAGAAGATATTATGG - Intronic
1066218790 10:33315250-33315272 TTTAAAAATAGAGGTTTTTAGGG + Intronic
1070732065 10:78836815-78836837 TTTAACAAAATAGGATCTTATGG + Intergenic
1071197694 10:83180098-83180120 TTTAATGAGAGAAGATCATGGGG - Intergenic
1071426730 10:85563610-85563632 TTTAAAAATAAAGGATATTATGG + Intergenic
1071892553 10:90027262-90027284 TTTAATGATTGAAGAATTTAAGG + Intergenic
1072306072 10:94108441-94108463 TTGAGTGCTAGAGAATCTTATGG - Intronic
1073901167 10:108222590-108222612 TTTTATGAGGGAGGAACTTAAGG + Intergenic
1074924184 10:118050059-118050081 TTAAATGTTAGAGGATCCTTTGG - Intergenic
1076560039 10:131356557-131356579 TTTAATGACAGAGGAACGAATGG + Intergenic
1078966329 11:16348661-16348683 TTTAATGATATAGGTTCAAATGG - Intronic
1080572311 11:33567452-33567474 TTGAATGAGAGAGCATCTGAGGG + Intronic
1081102144 11:39016475-39016497 TTTGATAATAGAGGACATTAGGG + Intergenic
1081399338 11:42624794-42624816 TTTAGTGATAGAGGGGTTTAGGG - Intergenic
1087987729 11:104705422-104705444 TTTAATGGTAGTGTATTTTATGG - Intergenic
1088265891 11:107987281-107987303 TTTAATGCTATAGGATCTGCGGG + Intergenic
1089582851 11:119492355-119492377 GTTTATAATAGAGGTTCTTAAGG + Intergenic
1090594500 11:128306814-128306836 TTTAAGGAAAGATGATCTTATGG + Intergenic
1091186518 11:133652458-133652480 TTTAATGGTAGAGAATCTTACGG - Intergenic
1092812453 12:12284488-12284510 TATAAAGATACAGGATTTTAGGG + Intergenic
1096139576 12:49231960-49231982 TTTAGGGATAGATGATCTAATGG - Intronic
1098106287 12:67070853-67070875 TTCAAGGATAGAGGAACTGAAGG + Intergenic
1098135830 12:67400851-67400873 TTTAATTATAGAGGATGATTGGG - Intergenic
1099894258 12:88625212-88625234 TTTAAAGATAGAGGCACTTCTGG + Intergenic
1100556210 12:95696412-95696434 CTTAATAATTGATGATCTTATGG + Intronic
1101792473 12:107940348-107940370 TTCAATGATACAGAATCTTATGG - Intergenic
1103194667 12:119032800-119032822 ATTAATGATAAAGAATCTGAAGG - Intronic
1106981362 13:35286122-35286144 AATCATGATAGAGAATCTTAGGG - Intronic
1107946618 13:45422475-45422497 TATAATGATAAAGAATTTTATGG - Intergenic
1108456240 13:50616878-50616900 TCTAATGAGAGATGATCTCATGG - Intronic
1108889775 13:55241840-55241862 TTTAATGATAGTGGTGCTTCTGG - Intergenic
1108889803 13:55242749-55242771 TTTAATGATAGTGGTGCTTCTGG + Intergenic
1109318593 13:60781763-60781785 TAAAATGATATAGGATCTGAAGG - Intergenic
1115166571 14:30454914-30454936 TTTAATGTTAGAGGGTCCCAAGG + Intergenic
1115607082 14:35014144-35014166 TTTAATAATAGTGGATGTAAGGG + Intronic
1119021153 14:71116593-71116615 TTTAATGCAAGAGGATCCCAAGG + Intergenic
1120087922 14:80296366-80296388 TTTAAAAATAGAGTAACTTATGG + Intronic
1123201812 14:106673376-106673398 TTTATTGATGGCTGATCTTATGG + Intergenic
1123692266 15:22848104-22848126 TTTTATGTTGGATGATCTTAAGG + Intronic
1123898119 15:24848725-24848747 GTTAAAAATAGAGAATCTTAAGG - Intronic
1126807659 15:52368285-52368307 TTTACTGAGAGTGGATGTTAAGG - Intronic
1128028466 15:64459958-64459980 TTTAGTGATAGAGGATGGTGAGG + Intergenic
1128629980 15:69254919-69254941 TTAAATGTTAGAGTACCTTAGGG - Intronic
1128848020 15:70918382-70918404 TATAATGTTACAGGATCTTTGGG - Intronic
1134235679 16:12463657-12463679 TTTAATAATAGAGGTTGCTATGG - Intronic
1135286682 16:21199493-21199515 TTTTAGAATAGAAGATCTTAAGG - Intronic
1137487225 16:48901720-48901742 TTCAGTGTTCGAGGATCTTAGGG + Intergenic
1138618004 16:58187020-58187042 CTTAATGTTAAAGGTTCTTATGG - Intronic
1141751100 16:85958581-85958603 TTAATTATTAGAGGATCTTAGGG + Intergenic
1143891987 17:10109386-10109408 TTTAATGATAGCTGTTCTAACGG - Intronic
1146430508 17:32789157-32789179 TTTTTTGATAAAGGGTCTTAGGG + Intronic
1146716776 17:35092731-35092753 TTTAATGAGAGAGGATGTGTAGG + Intronic
1146848137 17:36197835-36197857 CTTAATAATAAAGGATCTTGTGG - Intronic
1149469579 17:56904933-56904955 TTTATTGAAAGAGCATCATATGG - Intronic
1149757483 17:59199563-59199585 TCTAATGATAGAGGCAATTAGGG - Intronic
1151053023 17:71000909-71000931 TTTCATAAAAGAGGATATTAGGG - Intergenic
1154936060 18:21058306-21058328 TTTTATAATCTAGGATCTTAGGG - Intronic
1155690088 18:28609654-28609676 TTTAATGATAGATTTTATTATGG + Intergenic
1164380925 19:27736510-27736532 TTTAATGATAGAGACACTTAGGG - Intergenic
1165089910 19:33379883-33379905 TTAAATGATAGAGGTTTTTGTGG + Exonic
928634666 2:33231752-33231774 TGAAATGATTGAGAATCTTAAGG + Intronic
928929119 2:36605346-36605368 TTTAATTAAACAGTATCTTAGGG - Intronic
929282918 2:40102097-40102119 TTTAATTATAGAGAATCTTTAGG + Intronic
930144223 2:47984888-47984910 TTGAATGTTAGATGATATTAAGG - Intergenic
931581103 2:63775857-63775879 CTTACTGAATGAGGATCTTAAGG + Intronic
932492546 2:72131435-72131457 TTCACTGATAGAGAATCTTGGGG - Exonic
933794373 2:85907838-85907860 TTTTATGTTAAAGGATTTTATGG - Intergenic
937117115 2:119415601-119415623 TTTGATGGTAGAGGAACTTCTGG + Intergenic
940934040 2:159470771-159470793 TTTAATGATAGAGAATGTGAAGG + Intronic
941641104 2:167989349-167989371 TTTCATGATAGTTCATCTTAAGG - Intronic
942686206 2:178534747-178534769 TTTAATGGTAGAGCTTCTTCTGG + Exonic
943667467 2:190624919-190624941 TTTGATGATAGATGATTTAATGG - Intergenic
943787082 2:191889491-191889513 TTTAATGAAATAGGACCTTGAGG + Intergenic
943797457 2:192014513-192014535 TTGAAGGATAGGTGATCTTAAGG - Intronic
944901641 2:204222434-204222456 ATTAATGTTATAGGATCTTTGGG + Intergenic
947431902 2:230037178-230037200 TGTAATGCTGGAAGATCTTAAGG - Exonic
1172198003 20:33105299-33105321 TTTAATGATACAGGAACTACAGG + Intronic
1173887780 20:46476812-46476834 TATAATGATGGAGAATTTTATGG + Intergenic
1182817744 22:33181279-33181301 TTTAAAGATACATGATTTTATGG + Intronic
950847469 3:16028911-16028933 TTTAGTGATAGAGGACCTTATGG - Intergenic
951342831 3:21509981-21510003 TTAACTGAAAGAGGATCTTCTGG - Intronic
952361524 3:32634932-32634954 CTTAATGTTAGAGGAGTTTAGGG + Intergenic
952712552 3:36445994-36446016 TTTATTGATCAGGGATCTTATGG - Intronic
955649821 3:61182000-61182022 TTTAATGAGAAAGGATCCTGGGG + Intronic
956813214 3:72885202-72885224 TTAAATCATAAAGGATGTTATGG - Intergenic
957969837 3:87368641-87368663 CTTAATTTTAGAGGATCTTATGG - Intergenic
958980617 3:100714680-100714702 TTGAATGAAAAAGGATTTTATGG + Intronic
959931681 3:111991128-111991150 TTTTATAAAAGAGGATATTATGG - Intronic
960068832 3:113405688-113405710 TTAAATGATAGAGCAACTGAAGG - Intronic
963631430 3:147735717-147735739 ATAAATGGTAGAGGATCTTTAGG - Intergenic
963869881 3:150404472-150404494 TTTAGTGATAGGGGAACTGAGGG + Intergenic
964102965 3:153008775-153008797 CTTAATGAAAGAAGGTCTTAAGG + Intergenic
964451180 3:156815136-156815158 TTTAAAGATATATGCTCTTACGG + Intergenic
964683588 3:159369284-159369306 TTTATTGAAAAAGGATTTTATGG - Intronic
965208078 3:165747909-165747931 TTTACTTACAGAGGATCTGAGGG - Intergenic
965272086 3:166630045-166630067 TTTAAAGAGAGAGGATATTTAGG - Intergenic
965380270 3:167979765-167979787 TTTAATGATAGAAGGGCTTTAGG + Intergenic
967299072 3:187994435-187994457 TTTCATGATAGAGGGTTTTGTGG + Intergenic
974189014 4:58478653-58478675 TTTTATGAGACAGTATCTTATGG + Intergenic
975114987 4:70670423-70670445 TTTAATTATAGAAGCTATTATGG - Intronic
977088470 4:92636359-92636381 TTTAAAGTTAGAGGATGTTCAGG + Intronic
978359343 4:107911855-107911877 TTTAATGCTATTGGATCTTTTGG + Exonic
979521833 4:121676282-121676304 TTTAATGATAGAGAAAATCAGGG + Intronic
980736446 4:136895828-136895850 TTTAATTAGAGGAGATCTTAAGG + Intergenic
981248556 4:142570592-142570614 CTTAATTATAGAGCATCTTCTGG - Intronic
983506934 4:168563360-168563382 TTAAATGATAGAGAACCTCAAGG - Intronic
985043643 4:185917527-185917549 TTTTATTATAAAGGATATTATGG - Intronic
987921661 5:24290859-24290881 TTTGATAAAAGAGCATCTTAAGG + Intergenic
987943905 5:24579201-24579223 CTTAATTATAAAGTATCTTAAGG - Intronic
988913486 5:35869645-35869667 TTTAATAATAGAGGAATTGAAGG - Intronic
989836885 5:46004952-46004974 TTTAATTATAAATGATCTAAAGG - Intergenic
990042542 5:51390706-51390728 TTTAATGACAGCAGATTTTATGG - Intronic
992298117 5:75347132-75347154 TTAAATGTTAGAGCATCCTATGG - Intronic
993007731 5:82446443-82446465 TTTAATTACAGGGGATCATATGG - Intergenic
993339610 5:86707210-86707232 TTGAATCATAGAGGATGTTCAGG - Intergenic
993518559 5:88868402-88868424 TTGAGTGATAGAAGATTTTAAGG + Intronic
994397587 5:99238351-99238373 TTTGATGATAGAGTACCTCAGGG - Intergenic
994884734 5:105545535-105545557 TTTTCTGAGAGAAGATCTTAAGG + Intergenic
994961512 5:106610405-106610427 TTAAATGATAGAATACCTTAAGG + Intergenic
995783675 5:115804903-115804925 ATGAATAATAGAGGAACTTACGG - Exonic
998106895 5:139474417-139474439 TGTGATGATGGAGGATCTTCAGG + Intergenic
998717401 5:144900756-144900778 TTTAAGGATAGAGAAACTGAAGG + Intergenic
999190748 5:149745435-149745457 TTTAAAGACAGAGAAGCTTAAGG - Intronic
1000359729 5:160435852-160435874 TTGTATCATGGAGGATCTTAGGG + Intergenic
1004077873 6:12361809-12361831 TTTAATGCTAGGGGATTTGAGGG - Intergenic
1008799420 6:55348180-55348202 TTTACTGAAAGAGGAGCTGAAGG - Intronic
1009842727 6:69097017-69097039 TTTAATGTTAGAGGACATCAGGG - Intronic
1011278152 6:85649968-85649990 GTTAATAATAGAGGAAATTAGGG + Intergenic
1014525341 6:122495413-122495435 TTAAGTGGTAGAGGATCTGAGGG - Intronic
1016301796 6:142639981-142640003 GTTAATGATAGTGCCTCTTAGGG + Intergenic
1017340130 6:153311455-153311477 TTCAAAGACAGAGGATTTTAGGG - Intergenic
1018723859 6:166595700-166595722 TCTAATGTTAAATGATCTTAAGG + Intronic
1021383463 7:19998025-19998047 TGTAATGATAGAGAACCATACGG - Intergenic
1023725641 7:43140592-43140614 TTTAAGACTAGAGGATCTTTTGG - Intronic
1024447273 7:49495758-49495780 TATAAAGATAAAGGATCATATGG + Intergenic
1028722986 7:94055240-94055262 TTTAATGTCAAAGGATATTAAGG - Intergenic
1030947921 7:115749718-115749740 CTAGATGTTAGAGGATCTTAAGG + Intergenic
1034045323 7:147921186-147921208 ATGAATTAAAGAGGATCTTATGG + Intronic
1034754576 7:153604373-153604395 TCTAATGATACAGAGTCTTATGG + Intergenic
1035285527 7:157804066-157804088 TAAAATTAAAGAGGATCTTATGG + Intronic
1037031742 8:14115695-14115717 ATTAATGATAGAGGTTATCAAGG - Intronic
1037486766 8:19355227-19355249 TTTGATGATATAAGATCTTTGGG - Intronic
1039958710 8:42227687-42227709 TTTGTAGATAGATGATCTTATGG + Intergenic
1041038863 8:53825511-53825533 TTTAATGATAGAGGATCTTATGG - Intronic
1045327763 8:101129371-101129393 TTTAATGATAAAGGAATTTCCGG - Intergenic
1045851291 8:106701754-106701776 TTTACTGATAGAGAAACTAATGG - Intronic
1047864803 8:129011004-129011026 TTTAATAATAGAGACTCTGAAGG + Intergenic
1048824920 8:138415012-138415034 GTTAATGACTGAGGATCCTATGG + Intronic
1052049907 9:23833117-23833139 TTTAATGAGAGAGAAATTTATGG + Intergenic
1052207860 9:25865362-25865384 ATTATTGATAAAGGATATTAAGG - Intergenic
1052683057 9:31719088-31719110 TTTAATGAGAGAGACACTTAAGG - Intergenic
1053327124 9:37164139-37164161 TTTTTTGAAAGAGGATCTTCTGG + Intronic
1054911370 9:70458303-70458325 GTTAATGATGGAGGATATAATGG + Intergenic
1058270877 9:102969860-102969882 ATAAATATTAGAGGATCTTAAGG - Intergenic
1059555994 9:115281034-115281056 TTTAATGGAAGAGGTTCCTAAGG + Intronic
1060851121 9:126877119-126877141 TTTAATGATAAAAACTCTTAAGG + Intronic
1186087906 X:6011226-6011248 TTTAAATATAAAGGATCTTGTGG - Intronic
1189485922 X:41431668-41431690 CTTAATTATTGAGGATCTTCGGG + Intergenic
1189704198 X:43743563-43743585 TTTAATGATTGATGATCTGATGG + Intronic
1191248262 X:58245147-58245169 TTTAATGAAAGAGAAACTTTGGG + Intergenic
1192796027 X:74424311-74424333 TTTTATACTAGAGGTTCTTAGGG + Intronic
1193882364 X:86938720-86938742 TTTAATCAAAGAGGCTTTTATGG - Intergenic
1194577591 X:95632724-95632746 TTAAATGCTAGAGCATCTCAGGG + Intergenic
1196898877 X:120363907-120363929 TTTAATTAATGAGGATCTTTTGG + Intronic
1196964240 X:121038417-121038439 CCTGATCATAGAGGATCTTATGG + Intergenic
1198410002 X:136357042-136357064 TTTAATGATAGTGGATAATTTGG - Intronic