ID: 1041038867

View in Genome Browser
Species Human (GRCh38)
Location 8:53825520-53825542
Sequence ACCACCCAGTTTAATGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041038867_1041038869 -2 Left 1041038867 8:53825520-53825542 CCTCTATCATTAAACTGGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG No data
1041038867_1041038870 23 Left 1041038867 8:53825520-53825542 CCTCTATCATTAAACTGGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1041038870 8:53825566-53825588 TTCCAGAAGCAAAGTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041038867 Original CRISPR ACCACCCAGTTTAATGATAG AGG (reversed) Intronic
901104659 1:6745818-6745840 ATCACCCATTTAATTGATAGAGG + Intergenic
909923872 1:81415455-81415477 CACACCCAGTTTAATAATAGTGG + Intronic
912049309 1:105504683-105504705 ACCATTCAGTATAATGTTAGTGG - Intergenic
916092091 1:161315310-161315332 GTCACCCAGTTTAAAAATAGAGG + Intronic
917083635 1:171283160-171283182 ACCACCAAGTGTCATGATAGAGG + Exonic
917112892 1:171569548-171569570 ACCCCCCACTTTTATGAAAGTGG + Intronic
918315280 1:183317818-183317840 TCTACCCAGATTAATGACAGGGG + Intronic
922830769 1:228552757-228552779 ACCACGCATTCTAATGAGAGAGG - Intergenic
923343894 1:233032593-233032615 CCCTCCCAGTTTAATGAAAAGGG - Intronic
1065366921 10:24945797-24945819 ACCGGCCAGTTTGATGGTAGAGG - Intronic
1072208784 10:93227670-93227692 ACCACCCATTTCAATAACAGAGG + Intergenic
1076811344 10:132888206-132888228 TCCACCCCGTCTAATGGTAGCGG + Intronic
1085267936 11:75248357-75248379 AAACCCCAGTTTAATGATGGGGG - Intergenic
1085822613 11:79808996-79809018 ACCATCAAGTGTAATGGTAGTGG + Intergenic
1087439399 11:98163493-98163515 ACCAACCAGTTAAATGATATTGG - Intergenic
1090408172 11:126489843-126489865 ACCATCCTGTTTTTTGATAGAGG - Intronic
1095637153 12:44448304-44448326 ACCATCCAATTTAAAGCTAGGGG + Intergenic
1102497107 12:113327280-113327302 ACCAGGCAGTTTCATGAGAGAGG - Intronic
1104143201 12:126007659-126007681 TTCACCCATTTTACTGATAGAGG - Intergenic
1110922516 13:81106480-81106502 ACCAACCTGTTTACTGATATGGG + Intergenic
1117981344 14:61344898-61344920 ACCCCCCAGTTGATTGATTGAGG + Intronic
1118492441 14:66274033-66274055 AGCACCCAAGTTAATGACAGTGG - Intergenic
1118777812 14:68984542-68984564 ACCACCCTGTGAAATGATACTGG + Intergenic
1123053002 14:105556312-105556334 TCCACCCTGTTTAAAGAAAGAGG - Intergenic
1126076904 15:44920121-44920143 ACCTCCCAGTTTGATGAAGGTGG - Intergenic
1126081808 15:44970709-44970731 ACCTCCCAGTTTGATGAAGGTGG + Intronic
1126713684 15:51489751-51489773 AGCACTAAGTTAAATGATAGGGG - Intronic
1131848178 15:96510189-96510211 ACTACGCAGTTAGATGATAGTGG + Intergenic
1137053520 16:35732408-35732430 ACCAAGCAGTCTAATTATAGAGG - Intergenic
1139425274 16:66875579-66875601 ACCACCCAGGTGAGTGACAGGGG - Intergenic
1146468789 17:33108243-33108265 CCCAGGCAGTTTAATGATGGAGG - Intronic
1146853954 17:36248452-36248474 ACCACCCAGTTTTGTGCTATGGG - Intronic
1146866278 17:36337685-36337707 ACCACCCAGTTTTGTGCTATGGG - Intronic
1146869860 17:36372344-36372366 ACCACCCAGTTTTGTGCTATGGG - Intronic
1146877215 17:36423425-36423447 ACCACCCAGTTTTGTGCTATGGG - Intronic
1147069148 17:37938297-37938319 ACCACCCAGTTTTGTGCTATGGG - Intergenic
1147072739 17:37972968-37972990 ACCACCCAGTTTTGTGCTATGGG - Intergenic
1147080676 17:38017834-38017856 ACCACCCAGTTTTGTGCTATGGG - Intronic
1147084261 17:38052506-38052528 ACCACCCAGTTTTGTGCTATGGG - Intronic
1147096619 17:38141794-38141816 ACCACCCAGTTTTGTGCTATGGG - Intergenic
1147100209 17:38176472-38176494 ACCACCCAGTTTTGTGCTATGGG - Intergenic
1148876926 17:50693652-50693674 GCCACCCAGATTAATTAAAGTGG - Exonic
1149845190 17:60005173-60005195 ACCACCCAGTTTTGTGCTACGGG + Intergenic
1149874918 17:60222645-60222667 ACCACCCAGTTTCATGTTGCTGG + Intronic
1150779073 17:68104745-68104767 ACCAAACAGTTCACTGATAGTGG - Intergenic
1153988827 18:10376962-10376984 GCGAGCCATTTTAATGATAGTGG - Intergenic
1155549615 18:26951193-26951215 CCCACCCATGTTGATGATAGTGG - Intronic
1156392801 18:36666468-36666490 ATCACCCTGTCTAATGATACAGG - Intronic
1157543285 18:48528165-48528187 TCCACCAAGATTAAGGATAGTGG + Intergenic
1160415463 18:78706601-78706623 ACCAGCCACTGTAATGAGAGTGG + Intergenic
1163172255 19:15540470-15540492 AGCGCTCAGTTCAATGATAGCGG - Exonic
1164371390 19:27647228-27647250 CCCAGGCATTTTAATGATAGAGG - Intergenic
1164374168 19:27671186-27671208 CCCAGGCAGTCTAATGATAGAGG - Intergenic
1164374369 19:27672509-27672531 ACCAGGCAGTCTAATGTTAGAGG - Intergenic
1164382291 19:27745326-27745348 TCCAGGCAGTCTAATGATAGAGG - Intergenic
1164386032 19:27771239-27771261 CCCAGGCAGTCTAATGATAGAGG - Intergenic
1164451061 19:28365208-28365230 ACCAACCAAATTAATGATGGGGG + Intergenic
928721533 2:34126644-34126666 ACCACCAAGGTTAAGGATGGCGG + Intergenic
932294838 2:70615675-70615697 AACCCCCAGTGTAATGATATTGG - Intronic
936416044 2:112312948-112312970 ATCTCTCAGTTTAAAGATAGTGG + Intronic
938585970 2:132690945-132690967 ACCACCCTCTTTAAGGATGGAGG - Intronic
942627570 2:177918572-177918594 ACTAGCTAGTTTAATCATAGGGG + Intronic
943607089 2:189988378-189988400 GCCACCAAGTTAAATGAGAGGGG - Intronic
945247817 2:207736100-207736122 AACACCCAGTTTACAGATATGGG - Intronic
946956748 2:224938970-224938992 ACCACACAGTTTCATGAGAATGG + Intronic
1170774212 20:19361310-19361332 CCCATCCAGTTTCCTGATAGTGG + Intronic
1172164223 20:32889154-32889176 ACCACTAAGTCTAGTGATAGGGG - Intronic
1174099905 20:48119364-48119386 ACCTCTCAGTTTTATAATAGGGG - Intergenic
951962022 3:28336846-28336868 ACCTCCCAGTTTGATGAAGGTGG + Exonic
958536624 3:95412112-95412134 ACCAACCAGTTTAAGGTTTGGGG - Intergenic
958658501 3:97034905-97034927 ACCAAACAGTATAATGATAAAGG - Intronic
960038000 3:113120950-113120972 ACCCCCCAAATGAATGATAGAGG - Intergenic
974088769 4:57288741-57288763 ACCACAGAGTGTAATGAAAGGGG - Intergenic
975606887 4:76164130-76164152 ACCACCTAGTGTAATGAGTGAGG + Intronic
976779384 4:88741440-88741462 TCCACACAGTTAGATGATAGTGG + Intronic
977088468 4:92636350-92636372 ATCACCAAGTTTAAAGTTAGAGG + Intronic
979282959 4:118888046-118888068 ACCACCCAGATTCATGACATGGG + Intronic
984413188 4:179423428-179423450 CCCAGCTAGTTTAATTATAGTGG + Intergenic
990263093 5:54046613-54046635 AGCTGCCAGATTAATGATAGAGG + Intronic
993293379 5:86103791-86103813 ACCACTAAGTGTAATGTTAGTGG - Intergenic
999236145 5:150096834-150096856 ACCACTAAGTTTAATGTTAGTGG - Intronic
1001359391 5:171065739-171065761 ACCATACTGTTTAATGAAAGAGG + Intronic
1002782103 6:374895-374917 AGAACCCAGGTTAATGATTGTGG + Intergenic
1013439462 6:110148044-110148066 ACCACCAAGTTTATTTTTAGTGG + Intronic
1018572445 6:165225438-165225460 ACCCCCAAGTTTGATGATATAGG + Intergenic
1025150108 7:56540986-56541008 ACCACCAAGATTCATGATAGTGG - Intergenic
1026569558 7:71517374-71517396 AACACCCAGTATAATGGTAGTGG - Intronic
1032638421 7:133736732-133736754 ACTACCCAGGTTAATAATTGGGG - Intronic
1032806548 7:135360564-135360586 ACCACCAAGGTTAAAAATAGAGG - Intergenic
1033925140 7:146449737-146449759 ATCAACCAGTTTAATATTAGGGG - Intronic
1035934932 8:3826275-3826297 ACCACCCAGGGTAATGAAGGAGG + Intronic
1036188749 8:6650053-6650075 CCTACCCAGCTTAATGAGAGCGG - Intergenic
1041038867 8:53825520-53825542 ACCACCCAGTTTAATGATAGAGG - Intronic
1046881995 8:119319515-119319537 ACCACAGAGTTTACTAATAGGGG + Intergenic
1052727196 9:32243256-32243278 CCCAACCAGGTTACTGATAGTGG - Intergenic
1055677753 9:78682645-78682667 ACCACACATGTTAAGGATAGAGG - Intergenic
1185807533 X:3072491-3072513 ACCATCCTGGTTAATGCTAGAGG - Intronic
1185807568 X:3073464-3073486 ACCATCCTGGTTAATGCTAGAGG + Intronic
1185913733 X:4011101-4011123 GCCACACAGTTTCATGATAATGG - Intergenic
1191235323 X:58129353-58129375 ACCCACCATTCTAATGATAGAGG + Intergenic
1194073416 X:89356905-89356927 ACCACACACTTTTATGAAAGAGG + Intergenic
1200728799 Y:6708483-6708505 ACCACACACTTTTATGAAAGAGG + Intergenic
1202168021 Y:22013355-22013377 ACCACACAATTTAGTGATTGTGG + Intergenic
1202223340 Y:22573013-22573035 ACCACACAATTTAGTGATTGTGG - Intergenic
1202319775 Y:23622647-23622669 ACCACACAATTTAGTGATTGTGG + Intergenic
1202550993 Y:26047409-26047431 ACCACACAATTTAGTGATTGTGG - Intergenic