ID: 1041038869

View in Genome Browser
Species Human (GRCh38)
Location 8:53825541-53825563
Sequence GTGCTGGAGCATGAATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041038867_1041038869 -2 Left 1041038867 8:53825520-53825542 CCTCTATCATTAAACTGGGTGGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG No data
1041038863_1041038869 7 Left 1041038863 8:53825511-53825533 CCATAAGATCCTCTATCATTAAA 0: 1
1: 0
2: 2
3: 10
4: 174
Right 1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041038869 Original CRISPR GTGCTGGAGCATGAATACAC AGG Intronic
No off target data available for this crispr