ID: 1041040887

View in Genome Browser
Species Human (GRCh38)
Location 8:53844725-53844747
Sequence TGCTCGGAGAACGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041040887_1041040892 12 Left 1041040887 8:53844725-53844747 CCTGGGCTGGCGTTCTCCGAGCA No data
Right 1041040892 8:53844760-53844782 CAGACAATTTGCCTGGAGTAGGG No data
1041040887_1041040889 5 Left 1041040887 8:53844725-53844747 CCTGGGCTGGCGTTCTCCGAGCA No data
Right 1041040889 8:53844753-53844775 ACATTACCAGACAATTTGCCTGG No data
1041040887_1041040891 11 Left 1041040887 8:53844725-53844747 CCTGGGCTGGCGTTCTCCGAGCA No data
Right 1041040891 8:53844759-53844781 CCAGACAATTTGCCTGGAGTAGG No data
1041040887_1041040895 29 Left 1041040887 8:53844725-53844747 CCTGGGCTGGCGTTCTCCGAGCA No data
Right 1041040895 8:53844777-53844799 GTAGGGAGAAGAGAAGAGGCAGG No data
1041040887_1041040894 25 Left 1041040887 8:53844725-53844747 CCTGGGCTGGCGTTCTCCGAGCA No data
Right 1041040894 8:53844773-53844795 TGGAGTAGGGAGAAGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041040887 Original CRISPR TGCTCGGAGAACGCCAGCCC AGG (reversed) Intergenic