ID: 1041043686

View in Genome Browser
Species Human (GRCh38)
Location 8:53871639-53871661
Sequence TAATTACAACAGCTTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041043685_1041043686 6 Left 1041043685 8:53871610-53871632 CCATCTCAAAAAAAAAATAATAA 0: 181
1: 1380
2: 95926
3: 83643
4: 101689
Right 1041043686 8:53871639-53871661 TAATTACAACAGCTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041043686 Original CRISPR TAATTACAACAGCTTGTCCC TGG Intronic
No off target data available for this crispr