ID: 1041049105

View in Genome Browser
Species Human (GRCh38)
Location 8:53915695-53915717
Sequence GAAGACTCCTGGGGAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041049105_1041049109 -9 Left 1041049105 8:53915695-53915717 CCAGGTTCTCCCCAGGAGTCTTC 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1041049109 8:53915709-53915731 GGAGTCTTCTGAATCATCTGAGG No data
1041049105_1041049113 7 Left 1041049105 8:53915695-53915717 CCAGGTTCTCCCCAGGAGTCTTC 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1041049113 8:53915725-53915747 TCTGAGGACAAGGACAGGGCTGG No data
1041049105_1041049111 2 Left 1041049105 8:53915695-53915717 CCAGGTTCTCCCCAGGAGTCTTC 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1041049111 8:53915720-53915742 AATCATCTGAGGACAAGGACAGG No data
1041049105_1041049112 3 Left 1041049105 8:53915695-53915717 CCAGGTTCTCCCCAGGAGTCTTC 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1041049112 8:53915721-53915743 ATCATCTGAGGACAAGGACAGGG No data
1041049105_1041049110 -3 Left 1041049105 8:53915695-53915717 CCAGGTTCTCCCCAGGAGTCTTC 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1041049110 8:53915715-53915737 TTCTGAATCATCTGAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041049105 Original CRISPR GAAGACTCCTGGGGAGAACC TGG (reversed) Intronic
900390256 1:2430759-2430781 GATGTCACCTGGGGAGAACTGGG + Intronic
900884319 1:5404399-5404421 GACGTCTCCTGGAGAGACCCTGG - Intergenic
902299512 1:15491936-15491958 GAAGAGACCTGGCCAGAACCTGG - Intronic
902331360 1:15732597-15732619 GAGAACTCCTAGGGAGAGCCAGG - Exonic
902588784 1:17458724-17458746 GAAGTCTCTTGGGGAGAAGGGGG - Intergenic
903489903 1:23720451-23720473 GGAAACTCCTGCTGAGAACCTGG + Intergenic
903550577 1:24155171-24155193 GAAAACCCCTGGGGAGACACAGG + Exonic
904320818 1:29696940-29696962 GGAGGGCCCTGGGGAGAACCAGG - Intergenic
906569363 1:46822943-46822965 GAAGTTTCCTGGACAGAACCTGG - Intergenic
907349075 1:53811263-53811285 GAAGCCTCCTGGCCAGAACTTGG + Intronic
909209278 1:72802711-72802733 GAAGATTACTGGGGAGAGACAGG - Intergenic
910077537 1:83298679-83298701 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
910739063 1:90495020-90495042 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
911208164 1:95113557-95113579 GAAGACAGGTGGGGAGAAGCAGG + Intergenic
913336693 1:117715625-117715647 GAAGTTTCCTGGCCAGAACCTGG + Intergenic
916077765 1:161212414-161212436 GATGCCTCCTGGGGAGATCAAGG + Exonic
917057950 1:171004248-171004270 GAAGCCTCCTGGCCAGAACTCGG - Intronic
918283986 1:183034115-183034137 TAAGACTGCTGGGGAGAAAATGG + Intronic
919795242 1:201317729-201317751 TCAGCCTCCTGAGGAGAACCGGG + Exonic
922200061 1:223393794-223393816 GAAGATGCCTGGGGAGAGACAGG + Exonic
922494721 1:226047507-226047529 GAAGATTTCTGGAGAGTACCAGG - Intergenic
922722323 1:227905327-227905349 GAGGACTCCTGGGAATAGCCTGG + Intergenic
923587953 1:235292180-235292202 GCAGACTCTTGGGGACAATCAGG - Intronic
923874616 1:238034401-238034423 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
924014963 1:239711311-239711333 CAAGACTTTTGGGGAGCACCCGG - Intronic
924116058 1:240748379-240748401 GAATAATGCTGGGGTGAACCTGG - Intergenic
924909693 1:248497186-248497208 GAAGCTTCCTGGACAGAACCTGG - Intergenic
924914409 1:248550874-248550896 GAAGCTTCCTGGACAGAACCTGG + Intergenic
1063171173 10:3511253-3511275 GAAGTCTCCAGGGGAGAATCTGG - Intergenic
1063436243 10:6034750-6034772 GAAGACCCATTGGGAGAAGCAGG - Intronic
1064240038 10:13618873-13618895 GGAGACTCTTGGTGAGAATCTGG + Intronic
1067005869 10:42661476-42661498 GAAGGCTCTTGGAGAGATCCTGG - Intergenic
1068532882 10:58209241-58209263 GTGGAGTCCTGGGGAGAACAAGG + Intronic
1069112836 10:64468298-64468320 GAAGTCTCCTGGTCAGAACTTGG + Intergenic
1071024252 10:81093230-81093252 GAAGTCTCCTGGCCAGAACCCGG - Intergenic
1071484672 10:86091126-86091148 GAAGACTCCTGGCCAGAACTTGG + Intronic
1072263217 10:93702397-93702419 GACGACTCCGGGGGCGAACTTGG - Exonic
1074474163 10:113754482-113754504 CAAGACTCCTGAGGATAACCTGG - Intronic
1074740101 10:116478285-116478307 GAAGATTGCTGGGGAGAAGGAGG + Intergenic
1074862743 10:117524643-117524665 GAAGGCTGCTGGGGAGGCCCAGG - Intergenic
1075104436 10:119528997-119529019 GAAGTCTCCTGGGAGGAACAGGG + Intronic
1075982834 10:126755905-126755927 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1076666369 10:132095225-132095247 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1076713304 10:132350896-132350918 GAAAACACCTGGGGAAAACCAGG - Intronic
1076813743 10:132903468-132903490 GAAGAGTCGCGGGGAGAAACGGG - Intronic
1078214450 11:9299680-9299702 GAAAAATCCTGGGTAGAAGCTGG - Exonic
1078530742 11:12135028-12135050 GAAAACTCCTGGGGAAGGCCTGG - Intronic
1078683664 11:13505975-13505997 AAAGATACCTGGTGAGAACCAGG - Intergenic
1079273740 11:19013710-19013732 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1079791780 11:24748056-24748078 GAAGCCTCCTGGTTAGAACTGGG - Intronic
1080562533 11:33477179-33477201 GGAGACTCCTCTGGAGAAGCAGG - Intergenic
1081551683 11:44119354-44119376 GAAGACGCATGGGGTGAATCTGG + Intronic
1083424994 11:62578900-62578922 TCAGAATCCTGGGGAGAAGCAGG + Exonic
1083528594 11:63396205-63396227 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1084451210 11:69239836-69239858 GAAGACTGCTGGTCAGAAACAGG + Intergenic
1084941056 11:72613546-72613568 CAAGACTCCTGGAGAGGAACAGG - Intronic
1085747745 11:79129364-79129386 GAAGGCTCCTGGCCAGAACTTGG + Intronic
1086074344 11:82834439-82834461 GAAGAATCCTGTTGAGAACAAGG + Intronic
1086077758 11:82872656-82872678 GGGGACTCCTGGGGAGAGCCTGG - Intronic
1086300740 11:85423929-85423951 GAAGCCTCCTGGCCAGAACCTGG - Intronic
1088239459 11:107758679-107758701 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1088388104 11:109281926-109281948 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1089698392 11:120229410-120229432 GAACACTCCAGGGGAGATGCAGG - Exonic
1089954302 11:122556063-122556085 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1090225637 11:125070688-125070710 GAGGGCTCCTGGGGAGAACCTGG + Intronic
1091210588 11:133854806-133854828 GAAGCCTCCTGGTGAGAACACGG - Intergenic
1091940100 12:4471713-4471735 CAAAACTCCTGGGGAGAACTGGG + Intergenic
1092508082 12:9124795-9124817 GCAGACTCCTGGGCAGAAGGGGG + Intergenic
1092693678 12:11144594-11144616 GAAGCCTCCTGGCCAGAACTCGG - Intronic
1093172261 12:15874338-15874360 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1093525741 12:20102203-20102225 ACAGACTCCTGGGGAGAAAGGGG - Intergenic
1094362042 12:29640761-29640783 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1094501287 12:31023257-31023279 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1095665115 12:44788650-44788672 GAAGCCTCCTGGCCAGAACTTGG + Intronic
1095826138 12:46531661-46531683 GAACACTCGTTGGGAGACCCTGG + Intergenic
1095932010 12:47636828-47636850 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1097300718 12:58015836-58015858 GAAGACTGATAGGGAGTACCAGG - Intergenic
1098960987 12:76739488-76739510 GAAGCCTCCTGGCCAGAACCAGG - Intergenic
1099473355 12:83077350-83077372 TAAGACACTAGGGGAGAACCGGG - Intronic
1099477261 12:83122322-83122344 GAAGTCTCCTGGCCAGAACTTGG - Intronic
1101635346 12:106535768-106535790 GAAGCCTCCTGGCTAGAACTTGG - Intronic
1103086002 12:118061815-118061837 GAAGAAACCTGGGGAGAGCTGGG + Intronic
1103505428 12:121439805-121439827 TAACACTCCGTGGGAGAACCAGG - Intronic
1103632417 12:122272851-122272873 GAAGCCTCCAGTGGAGAACTGGG - Exonic
1103761179 12:123251339-123251361 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1104383233 12:128326476-128326498 CAAGACCCCTCTGGAGAACCAGG - Intronic
1104504566 12:129319103-129319125 GAAGCCTCCTGGCCAGAACTCGG - Intronic
1105990494 13:25615555-25615577 GAAGTTTCCTGGACAGAACCCGG - Intronic
1106301393 13:28469346-28469368 GAGGACTGCTGGGCATAACCAGG - Intronic
1106591401 13:31101838-31101860 GAAGACTCAGGGGGAGACTCTGG - Intergenic
1109213644 13:59563381-59563403 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1109498264 13:63204002-63204024 GAAGACTGCTGGGGACAACCTGG + Intergenic
1110561798 13:76917746-76917768 GAAGCCTCCTGGCCAGAACCAGG + Intergenic
1112738025 13:102443129-102443151 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
1114404932 14:22447798-22447820 AAGGCCTCATGGGGAGAACCAGG - Intergenic
1116346640 14:43802932-43802954 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1117510849 14:56449133-56449155 GAAGCCTCCTGGGTAGAACTTGG - Intergenic
1117639768 14:57785907-57785929 GAAGCCTCCTGGCCAGAACCTGG + Intronic
1118165528 14:63332278-63332300 GAAGTCTCCTGGCCAGAACTCGG + Intergenic
1118789202 14:69073756-69073778 GAATAGTCCTGGGGAGAAGAAGG + Intronic
1120552791 14:85891798-85891820 GAAGAATCCTGGGGTGATGCAGG + Intergenic
1121459789 14:94066002-94066024 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1122918528 14:104869919-104869941 GAGGACGCCTGGGGAGAAGCTGG - Intronic
1123924029 15:25090930-25090952 GAAGACTCCTGGGAAGAATTAGG - Intergenic
1123942535 15:25223549-25223571 AAAGACACAAGGGGAGAACCAGG - Intergenic
1123973577 15:25531482-25531504 CTAGGCTCCTGGGGAGAACTTGG + Intergenic
1124380660 15:29162301-29162323 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1126460864 15:48913601-48913623 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1126907537 15:53384131-53384153 GAAGACTCCATGGGAGAAGTTGG + Intergenic
1127031078 15:54863574-54863596 GAAGCCTCCTGGCTAGAACTTGG + Intergenic
1127194397 15:56568528-56568550 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
1128650078 15:69404827-69404849 GCAGACTCCTAGGGAAAACCAGG + Exonic
1129774810 15:78229780-78229802 GCAGAAGCCTGGGGAGAGCCTGG - Intronic
1130643549 15:85702481-85702503 TACGACTCCTGGGAAGATCCTGG - Intronic
1131018802 15:89080432-89080454 GAAGTGTTCTGGAGAGAACCAGG + Intergenic
1132014102 15:98300672-98300694 ACAGACTTCTGGGGAGAAGCAGG - Intergenic
1132210360 15:100017366-100017388 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1132247932 15:100311570-100311592 TAAGAGTCCAGGGGAGAACTGGG + Intronic
1132837210 16:1959993-1960015 GAAGAGTCCTGGGAAGAAGCGGG - Intronic
1138481667 16:57307403-57307425 GAAGACTCCTGGGGAAGGCAAGG - Intergenic
1138897843 16:61230262-61230284 GTAAACTCCTGCTGAGAACCTGG - Intergenic
1139031952 16:62894426-62894448 GAAGTATGCTGGAGAGAACCAGG - Intergenic
1140419595 16:74807543-74807565 GCAGAGTCCTGGGCAGAAGCAGG - Intergenic
1140474498 16:75232751-75232773 GAAGATGCCTGGGAAGTACCTGG - Intronic
1142893140 17:2957982-2958004 GAAGACTCCTGCGGAGGGACAGG + Intronic
1143497243 17:7319237-7319259 ACAGCCTCCTGGGAAGAACCAGG + Intronic
1144278425 17:13699538-13699560 GAAGTTTCCTGGACAGAACCTGG - Intergenic
1145876315 17:28320747-28320769 GAGGGCTCCAGGGGAGAATCTGG + Intronic
1146563821 17:33894803-33894825 GTAGACTGCTGGGGAGACCAAGG - Intronic
1147131757 17:38413736-38413758 TAAGACTCCTGGGGAGGGCCTGG + Intergenic
1148622684 17:49046167-49046189 GGTGACTAGTGGGGAGAACCTGG - Intronic
1148994498 17:51697835-51697857 GAAGTATCCTGGGGAAATCCAGG - Intronic
1151733334 17:75923597-75923619 GCAGACCCCAAGGGAGAACCAGG - Exonic
1151813960 17:76461955-76461977 GGAGGCCCCTGGGGAGAAGCGGG + Intronic
1152419138 17:80182672-80182694 GAAGACTCGAGGGAAGAACGGGG + Exonic
1152943826 17:83187269-83187291 CCAGACTGCTGGGGAGCACCTGG + Intergenic
1153116337 18:1661021-1661043 AAAGACTCCATGGGAGATCCAGG - Intergenic
1153930193 18:9871482-9871504 GATTCCTCCTGGGGAGATCCAGG - Intergenic
1156011447 18:32501690-32501712 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1157070061 18:44396219-44396241 CAAGACAAATGGGGAGAACCAGG - Intergenic
1157213677 18:45764404-45764426 GGACACTCCTGAGGAGCACCTGG - Intergenic
1157770578 18:50341770-50341792 GATGCCTCCAGAGGAGAACCAGG + Intergenic
1158002547 18:52636325-52636347 GAAGCCTCCTGGACAGAACTTGG + Intronic
1158518767 18:58152856-58152878 ATAGACTCCTGCAGAGAACCTGG + Intronic
1159151478 18:64528911-64528933 GAAGTCTCCTGGGGAGGAAAAGG - Intergenic
1159383352 18:67690912-67690934 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1161116144 19:2497560-2497582 GGAGGATCCAGGGGAGAACCTGG + Intergenic
1162078708 19:8206080-8206102 GAAGACACCTGGGGTCAGCCAGG - Intronic
1162786661 19:13039277-13039299 GAACACTCCTGGGCAGCAGCAGG - Intronic
1164107946 19:22125429-22125451 GAAGTCTCCTGGCCAGAACATGG + Intergenic
1164376869 19:27694997-27695019 GAAGACACCTGGGCAACACCAGG - Intergenic
1166604328 19:44127038-44127060 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1167283652 19:48586423-48586445 AGAGACTCCAGGGGAGAATCTGG - Intronic
1167330725 19:48854242-48854264 GTTGACTCCAGGGGAGGACCCGG + Exonic
1167702851 19:51060601-51060623 GAAGACTCCTGGGAGACACCTGG + Exonic
1167876221 19:52414848-52414870 GAAAACTTCTGGGAAGAAGCAGG - Intronic
1168259618 19:55186107-55186129 GAAGACGCCTGGGGTTACCCTGG + Intronic
1168565570 19:57419475-57419497 AAAGCCTACTGGGCAGAACCGGG - Intronic
925463231 2:4083248-4083270 GCTGACTTCTGGGAAGAACCAGG - Intergenic
925772233 2:7293992-7294014 GAAGAACCCTGGGGAGAAGCTGG + Intergenic
927114058 2:19884810-19884832 GAAGACTCATGTGGAGAAGTGGG - Intergenic
929805948 2:45145182-45145204 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
930688154 2:54330928-54330950 GGAGCCTCCTGGGAAGAACAGGG - Exonic
931847481 2:66219634-66219656 GAAGGCTACTGTGGAGAACCTGG - Intergenic
932024509 2:68119831-68119853 GAAGGGTGCTGGGGAGAACAGGG - Intergenic
932954704 2:76337649-76337671 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
933653095 2:84864854-84864876 GAAGACTCCTGTGGAGGAAGGGG - Intronic
933911253 2:86942832-86942854 GAAGAGTCCTGGGGGGACCGCGG + Intronic
935904963 2:107829673-107829695 GAAGAGTCCTGGGGGGACCGCGG + Intronic
936126740 2:109794745-109794767 GAAGAGTCCTGGGGGGACCGCGG + Intronic
936217957 2:110576741-110576763 GAAGAGTCCTGGGGGGACCGCGG - Intronic
936427294 2:112432815-112432837 GAAGAGTCCTGGGGGGACCGCGG - Intronic
937723112 2:125126553-125126575 GAAGTCTCCTGGCCAGAACTTGG - Intergenic
938881413 2:135593499-135593521 GGATAATCCTGGGGATAACCTGG - Intronic
940618747 2:156084132-156084154 GAAGCCTCCTGGGCAGAACTTGG - Intergenic
940785053 2:157971999-157972021 GAAGCCTCCTGGCCAGAAACTGG - Intronic
940802155 2:158144917-158144939 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
943621217 2:190150216-190150238 GAAGCCTCCTGGCCAGAACTCGG - Intronic
943971387 2:194411946-194411968 CCAGATTCCTGGGGAGTACCTGG + Intergenic
945212427 2:207397587-207397609 AAAGAGTCCTTGAGAGAACCTGG + Intergenic
945974096 2:216257561-216257583 GCAGAATCCTTGGGAGAGCCTGG + Intergenic
947346079 2:229190442-229190464 GAAGACTCCTGGAAGGAACTAGG + Intronic
948713913 2:239846771-239846793 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
948793037 2:240388953-240388975 GAAGACTCCTGGGGACTCCGGGG + Intergenic
1169517532 20:6333534-6333556 GAAGCCTCCTGGCTAGAACTTGG - Intergenic
1170495071 20:16915926-16915948 GAACACTCCATGGGACAACCTGG + Intergenic
1170863224 20:20128184-20128206 GAAGCCTCCTGGCCAGAACTCGG - Intronic
1171160371 20:22916752-22916774 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1173362600 20:42358054-42358076 GAAGACCTCTGTGGAAAACCTGG + Intronic
1174078240 20:47952983-47953005 GATGACTCCTAGGGTGAGCCTGG + Intergenic
1174167570 20:48596059-48596081 GGAGACTCCTGGGAAGAGGCAGG + Intergenic
1175581211 20:60101442-60101464 GCAGAGTCCAGGGGAGAGCCGGG + Intergenic
1175670275 20:60896682-60896704 GACGACTCCTGGTGAGCTCCTGG + Intergenic
1175943648 20:62549130-62549152 GCAGAGTCATGGGGAGAAGCCGG - Intergenic
1177195660 21:17901192-17901214 GAAGCCTCCTGGCCAGAACTGGG - Intergenic
1178801610 21:35801058-35801080 GAAGCCTCCTGGCCAGAACTTGG + Intronic
1179772710 21:43634971-43634993 AAAGACTACTGAGAAGAACCAGG + Intronic
1180954361 22:19735019-19735041 GAGGACTCCAGGAGACAACCTGG - Intergenic
1181095317 22:20501122-20501144 GAAGACCCCAGGGGAGAAGCAGG - Intronic
1181473488 22:23154731-23154753 GAAGACTCTGGGGGAGGAGCTGG - Intronic
1182273402 22:29170001-29170023 GAAGACTCAAGGGGAGCAGCAGG + Intergenic
1184118278 22:42434497-42434519 GCAGCCTCCTGGGGAGAGGCAGG + Intergenic
1185302618 22:50090330-50090352 GAAGCCTCCTGAGGCGAACGGGG - Intronic
949604111 3:5634694-5634716 GAAGCCTCCTGGCCAGAACTGGG - Intergenic
950592455 3:13948136-13948158 GAAGCCTCCTGGCAAGAACTCGG - Intronic
950603613 3:14058125-14058147 GAAGCCTCCTGGCCAGAACTTGG - Intronic
952260540 3:31735694-31735716 GAAGTCTCCTGTGTAGATCCAGG + Intronic
952312951 3:32206853-32206875 GTACACTCCTGGGAAGAACTTGG - Intergenic
952601474 3:35088816-35088838 GAAGTCTCCTGGTCAGAACCTGG + Intergenic
953103807 3:39855825-39855847 GCAGAGTCTTGGGGAGAAGCGGG - Intronic
954144114 3:48625885-48625907 GGGGACTCCTGGGTAGCACCTGG + Exonic
954353971 3:50069527-50069549 GAAGCCACCTGTGGAGAGCCAGG + Intronic
954704742 3:52473412-52473434 GGAAACTGCTGGGGAGAACAAGG - Intronic
955967561 3:64404509-64404531 GAATACTCTTGGGAAGTACCTGG - Intronic
956950204 3:74273799-74273821 GAAGCTTCCTGGCCAGAACCTGG + Intronic
957427071 3:80052023-80052045 GAACACTCATGGGGACACCCTGG + Intergenic
958013741 3:87914336-87914358 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
958048493 3:88316501-88316523 GAGGACTCCTGGAGAGAAGGAGG - Intergenic
958970008 3:100600970-100600992 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
959997199 3:112693118-112693140 GAAGCCTCCTGGCCAGAACTGGG + Intergenic
960016063 3:112889456-112889478 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
960380367 3:116953078-116953100 AAAGATTCCTGGGCAGAACAAGG - Intronic
960702675 3:120452156-120452178 GGAGACTACAGGGGAGAGCCTGG - Intergenic
961075420 3:123977576-123977598 GAAGTGTCCTGGGGTGAATCAGG + Intronic
961308266 3:125974940-125974962 GAAGCATCCTGGGGTGAATCAGG - Intronic
961550368 3:127667481-127667503 GAAGGCTGCTGGGGAGGAGCCGG + Intronic
963634597 3:147778207-147778229 GAAGGCTTCTGTGGAGAAACAGG - Intergenic
964160583 3:153640732-153640754 GAAGTCTCCTGGCCAGAACTCGG + Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965052761 3:163671608-163671630 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
965856345 3:173092632-173092654 GTAGACTCTAGGGGAGAATCTGG - Intronic
965874448 3:173299788-173299810 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
966712199 3:182981473-182981495 GAAGACTCCTGTGGAGTAAGTGG + Intronic
966992077 3:185242863-185242885 GAAGCCTCCTGGCCAGAACTCGG - Intronic
967141380 3:186564056-186564078 GAAGACACCTGAGGAGCGCCTGG - Exonic
967651281 3:191989980-191990002 GAAGTCTCCTGGTTAGAACCTGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968980565 4:3847017-3847039 CAACACTTGTGGGGAGAACCAGG + Intergenic
969574959 4:8031300-8031322 GCACACTCCTGGGAAGAGCCTGG - Intronic
969781578 4:9408675-9408697 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
970549373 4:17163907-17163929 GAAGCCTCCTGGTCAGAACTTGG - Intergenic
970658693 4:18260538-18260560 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
971952367 4:33369802-33369824 GAAGAACACTGGGAAGAACCAGG - Intergenic
972048752 4:34702287-34702309 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
973787022 4:54341838-54341860 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
974259521 4:59507521-59507543 GAAGACCTCTGGGGAGAAGAAGG - Intergenic
976856410 4:89609915-89609937 GAAGCCTCCTGGCCAGAACTGGG + Intergenic
977845460 4:101761777-101761799 GAAGTTTCCTGGGCAGAATCTGG - Intronic
978106484 4:104907698-104907720 GATGAGCCCTGGGAAGAACCAGG - Intergenic
978726763 4:111977976-111977998 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
979287325 4:118940905-118940927 GAAGAGTCCAGGGCAGAACCCGG - Intronic
979496171 4:121385391-121385413 GAAGAGTGCTGAGTAGAACCGGG - Intergenic
980237762 4:130131310-130131332 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
980523470 4:133960557-133960579 GAAGCCTCCTGGTCAGAACTCGG + Intergenic
981346568 4:143683652-143683674 GAAGCCTCCTGGCCAGAACCCGG + Intronic
981376725 4:144024825-144024847 GAAATCTCCTGGCCAGAACCTGG + Intergenic
981387226 4:144146171-144146193 GAAGTCTCCTGGCCAGAACCTGG + Intergenic
981401037 4:144313900-144313922 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
982218841 4:153107431-153107453 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
982491687 4:156038397-156038419 GAAGTCTCCTGGCCAGAACCTGG + Intergenic
984235716 4:177155729-177155751 GAAAACTCCTGGGTAGAAACAGG + Intergenic
985240875 4:187929730-187929752 GAAGTCTCCTGGCCAGAACCCGG - Intergenic
985540596 5:485740-485762 CGAGGCCCCTGGGGAGAACCTGG + Intronic
985553519 5:544890-544912 GAAGATGCCTGGGCAGGACCCGG - Intergenic
985767096 5:1785939-1785961 GTAGACTCCAGGGTAGACCCGGG - Intergenic
990624588 5:57597279-57597301 GGAGGCTCCAGGGGAGAATCTGG + Intergenic
991117350 5:62969907-62969929 GAAGCCTCCTGGCCAGAACTGGG + Intergenic
992034236 5:72756036-72756058 GAAGACTCCAAGGCAGTACCAGG - Intergenic
992340150 5:75814864-75814886 GAAGTCTCCTGGCCAGAACTCGG - Intergenic
992813212 5:80409767-80409789 AAAGGCTCCTGGGGACATCCAGG + Intronic
992898587 5:81270094-81270116 AAAGTCTCCTGGATAGAACCTGG + Intergenic
993916985 5:93755870-93755892 GAAGCCTCCTGGCCAGAACTCGG + Intronic
993964704 5:94346802-94346824 GAAGTCTCCTGGCCAGAACTTGG + Intronic
994051370 5:95365978-95366000 GAAGTCTCCTGGCCAGAACTCGG - Intergenic
994698519 5:103103323-103103345 AAAGACACATTGGGAGAACCAGG - Intronic
995694668 5:114865855-114865877 GAAGTCTCTTGGGCAGAACTTGG - Intergenic
995817741 5:116191284-116191306 GAAGCCTCCTGGCCAGAACTCGG + Intronic
996289003 5:121829351-121829373 GAAGACTCCTGGCCAGAACTTGG - Intergenic
996909430 5:128638283-128638305 AAAGACTGCTGGAGTGAACCAGG + Intronic
998522977 5:142817356-142817378 GAAGAGGCTTGGGTAGAACCAGG + Intronic
999365743 5:151022269-151022291 GAAGGCTAGTGGGGAGAACGTGG + Intronic
999484940 5:151985694-151985716 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
999818441 5:155200666-155200688 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1000511675 5:162190516-162190538 GAAGTCTCCTGGTCAGAACTCGG - Intergenic
1002813777 6:659849-659871 GAAGCCTCCTGGCCAGAACTTGG + Intronic
1003581881 6:7347561-7347583 GAAGCCTCCTGGCCAGAACGTGG + Intronic
1006117218 6:31781721-31781743 GAAGAGGCCAGAGGAGAACCAGG + Exonic
1006331895 6:33397633-33397655 GAAGACTGCTTGGGAGAATCAGG - Intronic
1006442500 6:34061045-34061067 GAAGCCTCCTGGGAAGGACTGGG + Intronic
1007256185 6:40530620-40530642 GACGGGTCCTGGGGAGAACCAGG - Intronic
1008528687 6:52434182-52434204 GAAGTCTCCTGGCCAGAACTCGG - Intronic
1008775465 6:55032325-55032347 GAAGTCTCCTGGCCAGAACTTGG - Intergenic
1009453105 6:63824895-63824917 GAAGCCTCCTGGCCAGAACTTGG + Intronic
1011720015 6:90145858-90145880 GAAGGCAGCTGGGGAGAAACCGG + Intronic
1011893378 6:92194408-92194430 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1012155898 6:95819615-95819637 TAAGTCTCCTGGTGAGAACTCGG + Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1013221386 6:108080653-108080675 GAAGTCTCCTGGCCAGAACCCGG - Intronic
1013877807 6:114855611-114855633 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1015362432 6:132355150-132355172 GAAGCCTCCTGGCCAGAACCTGG - Intronic
1015818887 6:137239068-137239090 GCAGACTCCTGGTGGAAACCAGG - Intergenic
1015849858 6:137560467-137560489 GGAGCCTCCTGGCCAGAACCTGG - Intergenic
1016290081 6:142518928-142518950 GAAGTCTCCTGGCCAGAACTCGG - Intergenic
1018115013 6:160574403-160574425 GAAGCCTCCTGGCCAGAACTTGG - Intronic
1019496215 7:1341713-1341735 GAGGGCTCCTGGGGGGATCCAGG + Intergenic
1020358634 7:7303794-7303816 GAAGTCTTCTGGCCAGAACCTGG - Intergenic
1021104036 7:16616683-16616705 GAAGTCTCCTCCGGAGATCCAGG - Intronic
1021323839 7:19242761-19242783 GAAGTTTCCTGGATAGAACCTGG - Intergenic
1021500734 7:21329769-21329791 GAACACTCCTTGGGACACCCTGG - Intergenic
1022474681 7:30702081-30702103 GAAGTCTCCTGAGCAGAAGCAGG + Intronic
1022777767 7:33545195-33545217 GAAGCCTCCTGGTCAGAACTTGG - Intronic
1022894920 7:34740404-34740426 GAAGTCTCCTGGACAGAACTTGG - Intronic
1023550755 7:41367816-41367838 GAAGTCTCCTGGTGAGGACATGG - Intergenic
1023864168 7:44231047-44231069 GAAGACTCCTGAGGAAACACGGG + Exonic
1024545405 7:50513467-50513489 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1024656162 7:51452854-51452876 GAATACTCCTGAGGATAACTTGG + Intergenic
1026144958 7:67738636-67738658 GAAGACTCAAGGGCAGGACCTGG - Intergenic
1027257739 7:76441999-76442021 GACACCTCCTGGTGAGAACCAGG - Exonic
1027281109 7:76610036-76610058 GACACCTCCTGGTGAGAACCAGG + Exonic
1027295312 7:76763884-76763906 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
1028183026 7:87747981-87748003 GAAGCCTCCTGGCCAGAACTCGG - Intronic
1030015307 7:105213444-105213466 TAAGAGTGCTGGGGAGAAACTGG + Intronic
1032808496 7:135383423-135383445 GCAGAGTGCTGGGGAGGACCAGG - Intronic
1034130755 7:148714741-148714763 GAACACACCTGGGCAGAACATGG + Intronic
1035833811 8:2727447-2727469 GAAGTCTCCTGGCCAGAACTCGG + Intergenic
1036837841 8:12090055-12090077 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1036859631 8:12336303-12336325 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1038237019 8:25769190-25769212 GAAGGCCCCTGGCCAGAACCTGG + Intergenic
1039571761 8:38592693-38592715 GAAGCCTTCTGGCCAGAACCTGG + Intergenic
1040109108 8:43558397-43558419 GAAGAATCCGGGGGAGAAGGAGG + Intergenic
1040565089 8:48557783-48557805 CAGGACTGCTGGAGAGAACCAGG + Intergenic
1040644454 8:49382106-49382128 GATGACTCCAGGGGTGCACCTGG - Intergenic
1041049105 8:53915695-53915717 GAAGACTCCTGGGGAGAACCTGG - Intronic
1041570626 8:59333433-59333455 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1042226853 8:66521063-66521085 GAAGAGTCCTGGGGAGGGCTTGG - Intergenic
1042467203 8:69141156-69141178 GAAGCCTCCTGGCCAGAACTCGG - Intergenic
1043040725 8:75259326-75259348 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
1044289459 8:90450867-90450889 GAAGATTTCTGGGAAGAACAAGG + Intergenic
1044791299 8:95849764-95849786 GTACACTCCAGGGGAGAAGCAGG + Intergenic
1045005449 8:97913253-97913275 GAAGACTCATGGGGAGAGTTGGG + Intronic
1045674007 8:104588711-104588733 GGAGACTCCCGCGGAGACCCTGG - Intronic
1048212511 8:132467172-132467194 GAAGACTCAAGGTGAGAGCCTGG + Intronic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1048443921 8:134479248-134479270 GACGACACCTGGGGAAAATCAGG - Intronic
1049001670 8:139829577-139829599 CAAGGCTCTTGGTGAGAACCAGG - Intronic
1049421106 8:142517105-142517127 GAAGAGCCCTGAGGGGAACCAGG + Intronic
1049657087 8:143803727-143803749 GAAGGCACCTGGGGAGAGGCTGG - Exonic
1052537080 9:29761276-29761298 GAAGACTCCTGGCCAGAACTTGG + Intergenic
1052731533 9:32291562-32291584 GAAGCCTCCTGGCCAGAACCTGG - Intergenic
1053186648 9:36022070-36022092 GAAGGCTGCTGTGAAGAACCTGG + Intergenic
1055347048 9:75350337-75350359 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1056753314 9:89367275-89367297 GAGGACTGCTGGGGAGCTCCTGG + Intronic
1057119567 9:92559122-92559144 GAAGCCTCCTGGCCAGAACTGGG - Intronic
1058308469 9:103471669-103471691 GAAGCCTCCTGGCCAGAACGTGG - Intergenic
1058941148 9:109813791-109813813 GATAACTCCTAGGTAGAACCAGG + Intronic
1060620316 9:125059344-125059366 GAAGGATCCAGGGGAGAATCAGG - Intronic
1060791666 9:126489420-126489442 CACGACTCTTGGGGAGACCCTGG - Intronic
1061560698 9:131400869-131400891 ATTGACTCCTGGGGAGATCCTGG + Intronic
1186728994 X:12388079-12388101 GAAAACTTCCGGGGAGAACTGGG + Intronic
1187430715 X:19221879-19221901 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1187773684 X:22730840-22730862 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1189962088 X:46333588-46333610 GAAGCCTCCTGGCCAGAACCTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191235181 X:58128409-58128431 GAAGACTCCTGGCCAACACCAGG + Intergenic
1191241380 X:58192660-58192682 AAAGACTCCTGGTGAAAACCAGG + Intergenic
1191779932 X:64854284-64854306 GAAGCCTCCTGGCCAGAACTTGG - Intergenic
1192820146 X:74636791-74636813 GAAGCCTCCTGGCCAGAACTCGG + Intergenic
1192881174 X:75285292-75285314 GAAGCCTCCTGGCCAGAACTAGG - Intronic
1192921675 X:75713459-75713481 GAAGTCTCCTGGCCAGAACATGG - Intergenic
1193420742 X:81279822-81279844 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1193791582 X:85821515-85821537 GAAGTCTCCTGGCCAGAACTTGG + Intergenic
1194093254 X:89603627-89603649 GAAGCCTCCTGGGGTGATACAGG - Intergenic
1194165311 X:90507813-90507835 GAAGATTCCTGGCCAGAACTTGG + Intergenic
1195795388 X:108641878-108641900 GAAGCCTCCTGGCCAGAACTCGG + Intronic
1197184333 X:123570102-123570124 GAAGTTTCCTGGACAGAACCTGG + Intergenic
1198843174 X:140880703-140880725 GAAGCCTCCTGGCCAGAACTTGG + Intergenic
1200445886 Y:3259730-3259752 GAAGCCTCCTGGGGTGATACAGG - Intergenic
1200511580 Y:4085623-4085645 GAAGATTCCTGGCCAGAACTTGG + Intergenic