ID: 1041062148

View in Genome Browser
Species Human (GRCh38)
Location 8:54044575-54044597
Sequence CTGGGGGGTGACGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041062130_1041062148 23 Left 1041062130 8:54044529-54044551 CCACAGCCCAGACCAAAACAGGC No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062141_1041062148 -10 Left 1041062141 8:54044562-54044584 CCACTTCCCTATGCTGGGGGGTG No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062138_1041062148 -7 Left 1041062138 8:54044559-54044581 CCTCCACTTCCCTATGCTGGGGG No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062136_1041062148 -6 Left 1041062136 8:54044558-54044580 CCCTCCACTTCCCTATGCTGGGG No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062128_1041062148 28 Left 1041062128 8:54044524-54044546 CCAGTCCACAGCCCAGACCAAAA No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062127_1041062148 29 Left 1041062127 8:54044523-54044545 CCCAGTCCACAGCCCAGACCAAA No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062133_1041062148 11 Left 1041062133 8:54044541-54044563 CCAAAACAGGCAAGTTTCCCTCC No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062132_1041062148 16 Left 1041062132 8:54044536-54044558 CCAGACCAAAACAGGCAAGTTTC No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data
1041062131_1041062148 17 Left 1041062131 8:54044535-54044557 CCCAGACCAAAACAGGCAAGTTT No data
Right 1041062148 8:54044575-54044597 CTGGGGGGTGACGGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041062148 Original CRISPR CTGGGGGGTGACGGGGTGGA AGG Intergenic
No off target data available for this crispr