ID: 1041065268

View in Genome Browser
Species Human (GRCh38)
Location 8:54076665-54076687
Sequence GAATGCCTTTAAGCGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041065268 Original CRISPR GAATGCCTTTAAGCGGGGCC AGG (reversed) Intronic
902598793 1:17526999-17527021 GGATGTCTCTAAGTGGGGCCGGG + Intergenic
903850371 1:26302073-26302095 GAATGACTCAAAGTGGGGCCAGG + Intronic
908235002 1:62140048-62140070 GAATGACTTTAGGCTGGGCAAGG - Intronic
915131265 1:153697316-153697338 AAATGCCTCTCAGCTGGGCCAGG + Intergenic
916231946 1:162549412-162549434 GAATGGCTTTAAGAAGGGCAAGG + Intergenic
917460048 1:175221880-175221902 GAATTCCTGTAGGTGGGGCCAGG - Intergenic
918065862 1:181101274-181101296 GAAGGCTTTTAAGTGGGGCAGGG + Intergenic
919478478 1:198056860-198056882 GGATGCAGTTAGGCGGGGCCAGG + Intergenic
1072332143 10:94364210-94364232 GAACGACTTTAGGCGGGGCGCGG - Intergenic
1074553237 10:114464479-114464501 GAAATCCTTTATGCTGGGCCAGG - Intronic
1075919146 10:126195948-126195970 GAATGCATCTAAGTGGGGCAGGG + Intronic
1076561656 10:131370470-131370492 GGATGCATTTAAGCCGGGCATGG - Intergenic
1078532904 11:12150745-12150767 GAGTGCCTTTAAGAGGGTGCCGG + Intronic
1089177825 11:116561134-116561156 AAAGGCCCCTAAGCGGGGCCAGG + Intergenic
1089290292 11:117433559-117433581 GAATTCCTTAAAATGGGGCCAGG + Intronic
1091795214 12:3294197-3294219 GAAATCCTTGAAGAGGGGCCCGG + Intergenic
1105657373 13:22455707-22455729 GAAAACCTTTGAGCGGGGGCTGG + Intergenic
1117989517 14:61420028-61420050 GAATGCCCATGAGCAGGGCCAGG - Intronic
1122546640 14:102526552-102526574 GAGAGCCTTAAAGAGGGGCCGGG - Intergenic
1131174016 15:90198959-90198981 GAATTGCTTGAACCGGGGCCTGG - Intronic
1137328865 16:47470393-47470415 GAATGCCTTTAAGCGGTTTTAGG + Intronic
1137665599 16:50247180-50247202 GAATGCCTTCAAACGTGGGCAGG + Intronic
1139371520 16:66472124-66472146 GGCAGCCTTTGAGCGGGGCCTGG - Intronic
1139966685 16:70749694-70749716 GAATGGCTTGAGGTGGGGCCTGG + Intronic
1142949813 17:3469786-3469808 CAATGCCTTAAAGTGGGGCATGG - Intronic
1146212938 17:30956240-30956262 GGATGCCTTCGAGCAGGGCCAGG + Exonic
1146957601 17:36945863-36945885 GAATGTCTTTAAAGGGGGCTAGG - Intergenic
1150235523 17:63589898-63589920 GAATGCCCTTGAGAGGAGCCAGG - Exonic
1157330773 18:46702380-46702402 GAATGGTTTTAAGCAGGGCCTGG - Intronic
1164175620 19:22771543-22771565 AAATGCTTTTTAGCTGGGCCCGG - Intronic
927758691 2:25730537-25730559 GAATTGCTTTAACCGGGACCTGG + Intergenic
930005957 2:46896984-46897006 GGAAGCCTTTAAGCTGGGCATGG + Intergenic
933645405 2:84809016-84809038 GAATTTCTTGAAGCAGGGCCTGG + Intronic
933704220 2:85277810-85277832 AAAAGCCTTTAAGCAGGGCCTGG - Intronic
937904356 2:127045730-127045752 GAATGCCTCTATGCAGGGCCTGG + Intergenic
940768912 2:157819568-157819590 GGATGCCTCTAGGAGGGGCCAGG - Intronic
943776680 2:191773940-191773962 GAATGCCTTTAAGAGCACCCAGG - Intergenic
946755861 2:222946939-222946961 TAATGCCTTTAATGGGGGCCTGG + Intergenic
1169633948 20:7666367-7666389 GAATGACTTGAAGTGGGGCAGGG - Intergenic
1173178831 20:40786337-40786359 GATAGCCTTGTAGCGGGGCCAGG + Intergenic
1175032935 20:55973482-55973504 GAGTGCTTTTAAGAGGGTCCTGG - Intergenic
1175270039 20:57727335-57727357 GAAGGTCTTTAACCAGGGCCCGG - Intergenic
949451411 3:4189358-4189380 GAATGCCTTTAAGTGATTCCAGG + Intronic
950467848 3:13165897-13165919 GCATGTCCGTAAGCGGGGCCCGG - Intergenic
954070400 3:48138843-48138865 GAAGGCCTTTGAGCTGGACCTGG + Intergenic
960060148 3:113312371-113312393 GAATTCCTTTAGGCTGGGCGGGG - Intronic
962018178 3:131466055-131466077 AAATGCATTTAAGCCAGGCCTGG - Intronic
965028876 3:163337113-163337135 AAATGGCTTTAAGCTGGGCATGG + Intergenic
969568124 4:7992223-7992245 GATTGCCTTGCAGAGGGGCCAGG - Intronic
972335617 4:38105048-38105070 GAATAACCTTAAGTGGGGCCGGG - Intronic
973095375 4:46191561-46191583 GAAATCCTTTAAAAGGGGCCTGG - Intergenic
974599157 4:64053896-64053918 GAATCGCTTTAACCGGGACCCGG - Intergenic
985791187 5:1927842-1927864 GCATTTCCTTAAGCGGGGCCGGG + Intergenic
994833387 5:104815558-104815580 GAATGCAATTAAGCTGGTCCTGG - Intergenic
999370779 5:151053938-151053960 GACAGCCTTTGAGCTGGGCCAGG + Intronic
1002603346 5:180367927-180367949 GCAGGCCTGTAAGCAGGGCCCGG + Intergenic
1004187373 6:13432495-13432517 GAATACCATTAAGCTGGGCGTGG - Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1019990190 7:4684663-4684685 GCAGGCCTCTAAGGGGGGCCTGG - Intronic
1028158474 7:87458942-87458964 GAATGGCTTTAAGCTGGACATGG - Intronic
1031584261 7:123515484-123515506 GAAGGCAATTAAGCAGGGCCAGG + Intronic
1033152607 7:138928575-138928597 GAATGCCTTTAGGCTGGGCATGG - Intronic
1038730164 8:30119776-30119798 AAATGCTTTTAAGTTGGGCCTGG + Intronic
1040352554 8:46583430-46583452 GAATGCCATTAGTCCGGGCCAGG - Intergenic
1041065268 8:54076665-54076687 GAATGCCTTTAAGCGGGGCCAGG - Intronic
1041118192 8:54560877-54560899 CAATGGCTTTAGGTGGGGCCTGG + Intergenic
1042960730 8:74301211-74301233 GAAAGAATTTAAGTGGGGCCAGG - Intronic
1042975497 8:74464666-74464688 GGATGCCTTTGAGTTGGGCCTGG + Intronic
1048900321 8:139031445-139031467 GAGTGCCTTTAAGCACGGGCAGG + Intergenic
1049085836 8:140477889-140477911 GAATGCTTTTAGGCTGGGCATGG + Intergenic
1049195245 8:141312131-141312153 GGATGCCTTGGAGCAGGGCCAGG + Intergenic
1051602412 9:18888591-18888613 GAAAGCCTTTGGGTGGGGCCTGG + Intronic
1059415529 9:114160011-114160033 GAATGCCTTTTCATGGGGCCAGG - Intronic
1059442153 9:114314437-114314459 GACTGCCTTCAAGCTGGGACAGG - Intergenic
1190335166 X:49257694-49257716 GAGTGCCTGTAAGTGGGGCAAGG + Exonic
1198264372 X:134995591-134995613 GAATGCTTTTAGGCCGGGCGCGG - Intergenic
1199898732 X:152152103-152152125 GAAATCCTTAAAGTGGGGCCGGG - Intergenic