ID: 1041073273 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:54145845-54145867 |
Sequence | CTGTTGTAGGTGAAGTAGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041073268_1041073273 | -5 | Left | 1041073268 | 8:54145827-54145849 | CCACTATTTACTTACCCTCTGTT | 0: 1 1: 0 2: 0 3: 15 4: 246 |
||
Right | 1041073273 | 8:54145845-54145867 | CTGTTGTAGGTGAAGTAGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041073273 | Original CRISPR | CTGTTGTAGGTGAAGTAGGT AGG | Intronic | ||
No off target data available for this crispr |