ID: 1041073273

View in Genome Browser
Species Human (GRCh38)
Location 8:54145845-54145867
Sequence CTGTTGTAGGTGAAGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041073268_1041073273 -5 Left 1041073268 8:54145827-54145849 CCACTATTTACTTACCCTCTGTT 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041073273 Original CRISPR CTGTTGTAGGTGAAGTAGGT AGG Intronic
No off target data available for this crispr