ID: 1041076286

View in Genome Browser
Species Human (GRCh38)
Location 8:54173060-54173082
Sequence AAGTGTGTGCATCATGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041076286_1041076288 -6 Left 1041076286 8:54173060-54173082 CCTTGTCCATGATGCACACACTT No data
Right 1041076288 8:54173077-54173099 ACACTTAGTTGTCTTCTTGTTGG No data
1041076286_1041076289 3 Left 1041076286 8:54173060-54173082 CCTTGTCCATGATGCACACACTT No data
Right 1041076289 8:54173086-54173108 TGTCTTCTTGTTGGCATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041076286 Original CRISPR AAGTGTGTGCATCATGGACA AGG (reversed) Intergenic
No off target data available for this crispr